Incidental Mutation 'R5829:Gdf9'
ID450331
Institutional Source Beutler Lab
Gene Symbol Gdf9
Ensembl Gene ENSMUSG00000018238
Gene Namegrowth differentiation factor 9
SynonymsGdf-9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R5829 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location53431023-53437904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 53433689 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 95 (T95M)
Ref Sequence ENSEMBL: ENSMUSP00000018382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018382] [ENSMUST00000061326] [ENSMUST00000109019] [ENSMUST00000109021]
Predicted Effect probably benign
Transcript: ENSMUST00000018382
AA Change: T95M

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000018382
Gene: ENSMUSG00000018238
AA Change: T95M

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TGFB 340 441 3.16e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061326
SMART Domains Protein: ENSMUSP00000053145
Gene: ENSMUSG00000044894

DomainStartEndE-ValueType
Pfam:UcrQ 2 81 3.7e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109019
Predicted Effect probably benign
Transcript: ENSMUST00000109021
SMART Domains Protein: ENSMUSP00000104649
Gene: ENSMUSG00000044894

DomainStartEndE-ValueType
Pfam:UcrQ 2 81 3.7e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156503
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates ovarian function. Female mice that are homozygous null for this gene are sterile with impaired folliculogenesis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Females homozygous for a targeted null mutation are sterile with a block in folliculogenesis. Mutant oocytes exhibit perinuclear organelle aggregation, unusual Golgi complexes, absence of cortical granules, and impaired granulosa cell connections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Atp6v1e2 T C 17: 86,944,716 R85G probably benign Het
Bmpr1b T C 3: 141,845,157 H391R probably benign Het
Camsap3 A G 8: 3,597,899 H69R probably damaging Het
Col12a1 C T 9: 79,633,673 G2391R probably damaging Het
Dab2ip ATCCT ATCCTCCT 2: 35,707,775 probably benign Het
Epha4 G A 1: 77,444,994 L284F probably benign Het
Fam166a G A 2: 25,218,857 probably null Het
Fat4 T C 3: 39,007,305 S4346P probably damaging Het
Fbxo22 T A 9: 55,218,312 probably null Het
Gcc1 C A 6: 28,419,691 probably benign Het
Gdf10 T C 14: 33,932,717 S394P probably damaging Het
Gm884 C T 11: 103,541,886 E1310K possibly damaging Het
Gpr179 G A 11: 97,335,698 S1877L probably benign Het
Gtf2i A G 5: 134,263,693 V380A probably damaging Het
Il17c G A 8: 122,422,231 R38Q probably damaging Het
Il17rd G A 14: 27,092,085 probably null Het
Iqch C T 9: 63,425,357 probably null Het
Mpp4 A T 1: 59,128,942 S456R probably damaging Het
Nek10 T C 14: 14,865,404 Y601H probably damaging Het
Nrxn2 C T 19: 6,490,849 P936L probably benign Het
Olfr907 T A 9: 38,499,249 Y193* probably null Het
Pcdhb9 T C 18: 37,401,889 V312A probably damaging Het
Pex5l T C 3: 33,005,990 T211A probably benign Het
Pik3c2a T C 7: 116,372,814 T794A probably benign Het
Pla2g6 A G 15: 79,287,693 F710L possibly damaging Het
Repin1 A T 6: 48,594,832 probably benign Het
Rev3l A T 10: 39,806,906 E340V probably damaging Het
Ryr3 A G 2: 112,859,731 S1158P probably damaging Het
S100a16 A T 3: 90,542,147 Q43L possibly damaging Het
Scg2 A G 1: 79,436,920 S29P probably damaging Het
Sfrp5 T C 19: 42,201,656 Y119C probably damaging Het
Sh3tc2 A G 18: 61,990,915 T916A probably benign Het
Smpd3 A G 8: 106,264,880 V347A probably benign Het
Tmem212 C A 3: 27,884,932 C135F possibly damaging Het
Unc13c T A 9: 73,693,368 N1365Y probably benign Het
Usp13 G T 3: 32,886,523 G395C possibly damaging Het
Vmn2r68 T C 7: 85,237,604 N34S probably benign Het
Other mutations in Gdf9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02148:Gdf9 APN 11 53436742 missense probably benign 0.02
R0688:Gdf9 UTSW 11 53436640 missense probably damaging 1.00
R1607:Gdf9 UTSW 11 53437511 missense possibly damaging 0.79
R1651:Gdf9 UTSW 11 53433749 missense probably damaging 0.98
R1902:Gdf9 UTSW 11 53436953 missense probably benign 0.26
R2128:Gdf9 UTSW 11 53437507 missense probably damaging 1.00
R5360:Gdf9 UTSW 11 53437207 missense probably benign 0.42
R5391:Gdf9 UTSW 11 53433797 missense probably benign
R5395:Gdf9 UTSW 11 53433797 missense probably benign
R5470:Gdf9 UTSW 11 53436754 missense probably benign 0.11
R5593:Gdf9 UTSW 11 53433731 missense probably damaging 0.99
R5809:Gdf9 UTSW 11 53433554 missense probably benign 0.03
R6394:Gdf9 UTSW 11 53436697 missense probably damaging 1.00
R6442:Gdf9 UTSW 11 53433688 missense probably benign 0.00
R6894:Gdf9 UTSW 11 53436819 missense possibly damaging 0.80
R7171:Gdf9 UTSW 11 53437539 missense probably damaging 1.00
R7650:Gdf9 UTSW 11 53437098 missense probably benign 0.06
Z1176:Gdf9 UTSW 11 53437525 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTACTGAAGAATCCCAGAGTGG -3'
(R):5'- TCAAAGTGTGGCTCCTTCTGG -3'

Sequencing Primer
(F):5'- ATCCCAGAGTGGAGCCAGTG -3'
(R):5'- GTAACAGAATCGGTAAAGCCTCTGTC -3'
Posted On2016-12-20