Incidental Mutation 'R5829:Pla2g6'
ID450339
Institutional Source Beutler Lab
Gene Symbol Pla2g6
Ensembl Gene ENSMUSG00000042632
Gene Namephospholipase A2, group VI
SynonymsiPLA2beta, iPLA2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5829 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location79286228-79328390 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79287693 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 710 (F710L)
Ref Sequence ENSEMBL: ENSMUSP00000134672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047816] [ENSMUST00000165408] [ENSMUST00000166977] [ENSMUST00000169462] [ENSMUST00000170955] [ENSMUST00000172403] [ENSMUST00000173163] [ENSMUST00000174021]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047816
AA Change: F655L

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000044234
Gene: ENSMUSG00000042632
AA Change: F655L

DomainStartEndE-ValueType
low complexity region 96 109 N/A INTRINSIC
ANK 151 181 2.97e-3 SMART
ANK 185 215 4.6e0 SMART
ANK 219 248 3.23e-4 SMART
ANK 286 312 1.52e0 SMART
ANK 316 345 6.46e-4 SMART
ANK 349 378 2.02e-5 SMART
Pfam:Patatin 427 611 6.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165408
SMART Domains Protein: ENSMUSP00000127816
Gene: ENSMUSG00000018126

DomainStartEndE-ValueType
Pfam:IMD 16 226 1e-90 PFAM
low complexity region 232 244 N/A INTRINSIC
SH3 327 386 2.54e-9 SMART
low complexity region 389 409 N/A INTRINSIC
low complexity region 443 472 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166977
AA Change: F655L

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132071
Gene: ENSMUSG00000042632
AA Change: F655L

DomainStartEndE-ValueType
low complexity region 96 109 N/A INTRINSIC
ANK 151 181 2.97e-3 SMART
ANK 185 215 4.6e0 SMART
ANK 219 248 3.23e-4 SMART
ANK 286 312 1.52e0 SMART
ANK 316 345 6.46e-4 SMART
ANK 349 378 2.02e-5 SMART
Pfam:Patatin 427 611 6.7e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169462
SMART Domains Protein: ENSMUSP00000130698
Gene: ENSMUSG00000018126

DomainStartEndE-ValueType
Pfam:IMD 16 226 3.8e-83 PFAM
low complexity region 232 244 N/A INTRINSIC
low complexity region 258 299 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170955
SMART Domains Protein: ENSMUSP00000125946
Gene: ENSMUSG00000018126

DomainStartEndE-ValueType
Pfam:IMD 16 211 1.4e-75 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172403
AA Change: F655L

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131081
Gene: ENSMUSG00000042632
AA Change: F655L

DomainStartEndE-ValueType
low complexity region 96 109 N/A INTRINSIC
ANK 151 181 2.97e-3 SMART
ANK 185 215 4.6e0 SMART
ANK 219 248 3.23e-4 SMART
ANK 286 312 1.52e0 SMART
ANK 316 345 6.46e-4 SMART
ANK 349 378 2.02e-5 SMART
Pfam:Patatin 427 611 6.7e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173163
AA Change: F655L

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134456
Gene: ENSMUSG00000042632
AA Change: F655L

DomainStartEndE-ValueType
low complexity region 96 109 N/A INTRINSIC
ANK 151 181 2.97e-3 SMART
ANK 185 215 4.6e0 SMART
ANK 219 248 3.23e-4 SMART
ANK 286 312 1.52e0 SMART
ANK 316 345 6.46e-4 SMART
ANK 349 378 2.02e-5 SMART
Pfam:Patatin 427 611 6.7e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174021
AA Change: F710L

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134672
Gene: ENSMUSG00000042632
AA Change: F710L

DomainStartEndE-ValueType
low complexity region 96 109 N/A INTRINSIC
ANK 151 181 2.97e-3 SMART
ANK 185 215 4.6e0 SMART
ANK 219 248 3.23e-4 SMART
ANK 286 312 1.52e0 SMART
ANK 316 345 6.46e-4 SMART
ANK 349 378 2.02e-5 SMART
Blast:ANK 382 411 2e-8 BLAST
Pfam:Patatin 482 666 2.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229011
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an A2 phospholipase, a class of enzyme that catalyzes the release of fatty acids from phospholipids. The encoded protein may play a role in phospholipid remodelling, arachidonic acid release, leukotriene and prostaglandin synthesis, fas-mediated apoptosis, and transmembrane ion flux in glucose-stimulated B-cells. Several transcript variants encoding multiple isoforms have been described, but the full-length nature of only three of them have been determined to date. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous null mice display impaired male fertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Atp6v1e2 T C 17: 86,944,716 R85G probably benign Het
Bmpr1b T C 3: 141,845,157 H391R probably benign Het
Camsap3 A G 8: 3,597,899 H69R probably damaging Het
Col12a1 C T 9: 79,633,673 G2391R probably damaging Het
Dab2ip ATCCT ATCCTCCT 2: 35,707,775 probably benign Het
Epha4 G A 1: 77,444,994 L284F probably benign Het
Fam166a G A 2: 25,218,857 probably null Het
Fat4 T C 3: 39,007,305 S4346P probably damaging Het
Fbxo22 T A 9: 55,218,312 probably null Het
Gcc1 C A 6: 28,419,691 probably benign Het
Gdf10 T C 14: 33,932,717 S394P probably damaging Het
Gdf9 C T 11: 53,433,689 T95M probably benign Het
Gm884 C T 11: 103,541,886 E1310K possibly damaging Het
Gpr179 G A 11: 97,335,698 S1877L probably benign Het
Gtf2i A G 5: 134,263,693 V380A probably damaging Het
Il17c G A 8: 122,422,231 R38Q probably damaging Het
Il17rd G A 14: 27,092,085 probably null Het
Iqch C T 9: 63,425,357 probably null Het
Mpp4 A T 1: 59,128,942 S456R probably damaging Het
Nek10 T C 14: 14,865,404 Y601H probably damaging Het
Nrxn2 C T 19: 6,490,849 P936L probably benign Het
Olfr907 T A 9: 38,499,249 Y193* probably null Het
Pcdhb9 T C 18: 37,401,889 V312A probably damaging Het
Pex5l T C 3: 33,005,990 T211A probably benign Het
Pik3c2a T C 7: 116,372,814 T794A probably benign Het
Repin1 A T 6: 48,594,832 probably benign Het
Rev3l A T 10: 39,806,906 E340V probably damaging Het
Ryr3 A G 2: 112,859,731 S1158P probably damaging Het
S100a16 A T 3: 90,542,147 Q43L possibly damaging Het
Scg2 A G 1: 79,436,920 S29P probably damaging Het
Sfrp5 T C 19: 42,201,656 Y119C probably damaging Het
Sh3tc2 A G 18: 61,990,915 T916A probably benign Het
Smpd3 A G 8: 106,264,880 V347A probably benign Het
Tmem212 C A 3: 27,884,932 C135F possibly damaging Het
Unc13c T A 9: 73,693,368 N1365Y probably benign Het
Usp13 G T 3: 32,886,523 G395C possibly damaging Het
Vmn2r68 T C 7: 85,237,604 N34S probably benign Het
Other mutations in Pla2g6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Pla2g6 APN 15 79289241 missense probably damaging 0.96
IGL00906:Pla2g6 APN 15 79287747 missense probably damaging 1.00
IGL01432:Pla2g6 APN 15 79317968 start codon destroyed probably null 1.00
IGL01640:Pla2g6 APN 15 79304313 missense probably benign
IGL01715:Pla2g6 APN 15 79317857 missense probably benign 0.00
IGL01943:Pla2g6 APN 15 79313116 missense probably null 0.00
IGL02551:Pla2g6 APN 15 79299094 missense possibly damaging 0.95
IGL03120:Pla2g6 APN 15 79286860 missense probably damaging 1.00
IGL03193:Pla2g6 APN 15 79317785 missense probably damaging 0.98
IGL03194:Pla2g6 APN 15 79317785 missense probably damaging 0.98
IGL03205:Pla2g6 APN 15 79317785 missense probably damaging 0.98
IGL03289:Pla2g6 APN 15 79317785 missense probably damaging 0.98
R0288:Pla2g6 UTSW 15 79286906 splice site probably benign
R0631:Pla2g6 UTSW 15 79306396 missense probably damaging 1.00
R1216:Pla2g6 UTSW 15 79306435 missense probably benign 0.18
R1617:Pla2g6 UTSW 15 79289141 missense probably benign 0.03
R1785:Pla2g6 UTSW 15 79306345 missense probably benign 0.02
R2025:Pla2g6 UTSW 15 79286764 missense probably damaging 1.00
R2079:Pla2g6 UTSW 15 79312994 missense probably damaging 1.00
R3952:Pla2g6 UTSW 15 79313096 missense probably damaging 1.00
R4774:Pla2g6 UTSW 15 79287618 missense probably damaging 1.00
R4826:Pla2g6 UTSW 15 79308679 missense possibly damaging 0.96
R5093:Pla2g6 UTSW 15 79287128 missense probably benign 0.12
R5327:Pla2g6 UTSW 15 79302637 missense probably benign 0.03
R5390:Pla2g6 UTSW 15 79289693 missense possibly damaging 0.72
R5419:Pla2g6 UTSW 15 79299142 missense possibly damaging 0.82
R5432:Pla2g6 UTSW 15 79302617 critical splice donor site probably null
R5633:Pla2g6 UTSW 15 79299142 missense possibly damaging 0.82
R5930:Pla2g6 UTSW 15 79303528 intron probably benign
R6228:Pla2g6 UTSW 15 79305724 missense probably benign 0.00
R6241:Pla2g6 UTSW 15 79304392 missense probably benign 0.02
R6339:Pla2g6 UTSW 15 79308816 missense probably damaging 0.99
R6485:Pla2g6 UTSW 15 79307372 missense probably benign 0.00
R6754:Pla2g6 UTSW 15 79306310 missense probably benign 0.01
R7419:Pla2g6 UTSW 15 79305698 splice site probably null
R7425:Pla2g6 UTSW 15 79308733 missense probably damaging 1.00
R7710:Pla2g6 UTSW 15 79287158 missense probably damaging 0.98
R7738:Pla2g6 UTSW 15 79297433 nonsense probably null
R7768:Pla2g6 UTSW 15 79297314 missense probably damaging 1.00
R7796:Pla2g6 UTSW 15 79317825 missense probably benign 0.32
R8184:Pla2g6 UTSW 15 79287122 missense probably benign 0.02
R8359:Pla2g6 UTSW 15 79287170 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGACTGTCTCCCAAAGCTG -3'
(R):5'- AAGTGGTTGTGATGCCCAC -3'

Sequencing Primer
(F):5'- TGTCTCCCAAAGCTGGCTGAC -3'
(R):5'- ATGGAACCTGGGTCTGCTC -3'
Posted On2016-12-20