Mutagenetix > Incidental Mutations

Incidental Mutation 'R5829:Sfrp5'

450346

Institutional Source

Beutler Lab

Gene Symbol

Sfrp5

Ensembl Gene

ENSMUSG00000018822

Gene Name

secreted frizzled-related sequence protein 5

Synonyms

SARP3

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5829 (G1)

Quality Score

107

Status

Not validated

Chromosome

Chromosomal Location

42197971-42202252 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 42201656 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 119 (Y119C)

Ref Sequence

ENSEMBL: ENSMUSP00000018966 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018966]

Predicted Effect

probably damaging
Transcript: ENSMUST00000018966
AA Change: Y119C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000018966
Gene: ENSMUSG00000018822
AA Change: Y119C

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
FRI	49	164	6.28e-58	SMART
C345C	191	294	1e-17	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Secreted frizzled-related protein 5 (SFRP5) is a member of the SFRP family that contains a cysteine-rich domain homologous to the putative Wnt-binding site of Frizzled proteins. SFRPs act as soluble modulators of Wnt signaling. SFRP5 and SFRP1 may be involved in determining the polarity of photoreceptor cells in the retina. SFRP5 is highly expressed in the retinal pigment epithelium, and moderately expressed in the pancreas. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no developmental abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	C	A	11: 109,977,813	G175V	probably damaging	Het
Atp6v1e2	T	C	17: 86,944,716	R85G	probably benign	Het
Bmpr1b	T	C	3: 141,845,157	H391R	probably benign	Het
Camsap3	A	G	8: 3,597,899	H69R	probably damaging	Het
Col12a1	C	T	9: 79,633,673	G2391R	probably damaging	Het
Dab2ip	ATCCT	ATCCTCCT	2: 35,707,775		probably benign	Het
Epha4	G	A	1: 77,444,994	L284F	probably benign	Het
Fam166a	G	A	2: 25,218,857		probably null	Het
Fat4	T	C	3: 39,007,305	S4346P	probably damaging	Het
Fbxo22	T	A	9: 55,218,312		probably null	Het
Gcc1	C	A	6: 28,419,691		probably benign	Het
Gdf10	T	C	14: 33,932,717	S394P	probably damaging	Het
Gdf9	C	T	11: 53,433,689	T95M	probably benign	Het
Gm884	C	T	11: 103,541,886	E1310K	possibly damaging	Het
Gpr179	G	A	11: 97,335,698	S1877L	probably benign	Het
Gtf2i	A	G	5: 134,263,693	V380A	probably damaging	Het
Il17c	G	A	8: 122,422,231	R38Q	probably damaging	Het
Il17rd	G	A	14: 27,092,085		probably null	Het
Iqch	C	T	9: 63,425,357		probably null	Het
Mpp4	A	T	1: 59,128,942	S456R	probably damaging	Het
Nek10	T	C	14: 14,865,404	Y601H	probably damaging	Het
Nrxn2	C	T	19: 6,490,849	P936L	probably benign	Het
Olfr907	T	A	9: 38,499,249	Y193*	probably null	Het
Pcdhb9	T	C	18: 37,401,889	V312A	probably damaging	Het
Pex5l	T	C	3: 33,005,990	T211A	probably benign	Het
Pik3c2a	T	C	7: 116,372,814	T794A	probably benign	Het
Pla2g6	A	G	15: 79,287,693	F710L	possibly damaging	Het
Repin1	A	T	6: 48,594,832		probably benign	Het
Rev3l	A	T	10: 39,806,906	E340V	probably damaging	Het
Ryr3	A	G	2: 112,859,731	S1158P	probably damaging	Het
S100a16	A	T	3: 90,542,147	Q43L	possibly damaging	Het
Scg2	A	G	1: 79,436,920	S29P	probably damaging	Het
Sh3tc2	A	G	18: 61,990,915	T916A	probably benign	Het
Smpd3	A	G	8: 106,264,880	V347A	probably benign	Het
Tmem212	C	A	3: 27,884,932	C135F	possibly damaging	Het
Unc13c	T	A	9: 73,693,368	N1365Y	probably benign	Het
Usp13	G	T	3: 32,886,523	G395C	possibly damaging	Het
Vmn2r68	T	C	7: 85,237,604	N34S	probably benign	Het

Other mutations in Sfrp5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02387:Sfrp5	APN	19	42199029	missense	probably benign	0.00
IGL03347:Sfrp5	APN	19	42198768	missense	probably benign	0.00
R1686:Sfrp5	UTSW	19	42201704	missense	possibly damaging	0.88
R1911:Sfrp5	UTSW	19	42198798	missense	probably benign
R2005:Sfrp5	UTSW	19	42198836	missense	probably benign	0.03
R3815:Sfrp5	UTSW	19	42198791	missense	probably benign	0.06
R3930:Sfrp5	UTSW	19	42201818	missense	probably damaging	1.00
R5980:Sfrp5	UTSW	19	42201972	missense	unknown
R6351:Sfrp5	UTSW	19	42201824	missense	possibly damaging	0.91
R6702:Sfrp5	UTSW	19	42201827	missense	probably benign	0.02
R6764:Sfrp5	UTSW	19	42199799	missense	probably benign	0.00
R6836:Sfrp5	UTSW	19	42201710	missense	probably damaging	0.97
R6895:Sfrp5	UTSW	19	42199788	missense	probably damaging	1.00
R7024:Sfrp5	UTSW	19	42201765	missense	possibly damaging	0.56
R7543:Sfrp5	UTSW	19	42198863	missense	possibly damaging	0.67
R8442:Sfrp5	UTSW	19	42198797	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTTGGGGAGAGGATCAGTCC -3'
(R):5'- GTACGACTACTACGGTTGGCAG -3'

Sequencing Primer
(F):5'- ATCAGTCCGAGGCGCTCTG -3'
(R):5'- CTCTGTCACACGGTGGGCTAC -3'

Posted On

2016-12-20