Mutagenetix > Incidental Mutation

Incidental Mutation 'R0549:Rnf213'

45035

Institutional Source

Beutler Lab

Gene Symbol

Rnf213

Ensembl Gene

ENSMUSG00000070327

Gene Name

ring finger protein 213

Synonyms

D11Ertd759e

MMRRC Submission

038741-MU

Accession Numbers

Genbank: XM_001477846.2; Ensembl: ENSMUST00000131035, ENSMUST00000082107, ENSMUST00000093902, ENSMUST00000169768, ENSMUST00000172235

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0549 (G1)

Quality Score

181

Status

Validated

Chromosome

Chromosomal Location

119393100-119487418 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 119465082 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 4117 (T4117M)

Ref Sequence

ENSEMBL: ENSMUSP00000115063 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000093902
AA Change: T4118M

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327
AA Change: T4118M

Domain	Start	End	E-Value	Type
low complexity region	130	146	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	319	335	N/A	INTRINSIC
low complexity region	676	688	N/A	INTRINSIC
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1546	1558	N/A	INTRINSIC
AAA	2373	2515	2.82e-2	SMART
AAA	2722	2890	3.63e-1	SMART
low complexity region	3449	3459	N/A	INTRINSIC
RING	3947	3985	8.69e-5	SMART
Blast:PP2Ac	4544	4722	3e-66	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000131035
AA Change: T4117M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327
AA Change: T4117M

Domain	Start	End	E-Value	Type
low complexity region	130	146	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	319	335	N/A	INTRINSIC
low complexity region	676	688	N/A	INTRINSIC
low complexity region	1113	1127	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
AAA	2372	2514	2.82e-2	SMART
AAA	2721	2889	3.63e-1	SMART
low complexity region	3448	3458	N/A	INTRINSIC
RING	3946	3984	8.69e-5	SMART
Blast:PP2Ac	4542	4720	3e-66	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207133

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207446

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208476

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 96.9%
20x: 94.3%

Validation Efficiency

96% (48/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc10	A	G	17: 46,322,290 (GRCm38)	F498L	probably damaging	Het
Adamts6	A	T	13: 104,297,255 (GRCm38)	D64V	possibly damaging	Het
Agbl2	T	C	2: 90,789,843 (GRCm38)		probably benign	Het
Angptl3	A	G	4: 99,031,455 (GRCm38)	S151G	probably benign	Het
Arhgap39	C	T	15: 76,734,886 (GRCm38)	D833N	probably damaging	Het
C4b	G	T	17: 34,735,415 (GRCm38)	L927I	probably damaging	Het
Ccl3	T	C	11: 83,648,336 (GRCm38)	T66A	probably damaging	Het
Cdh7	T	C	1: 110,108,944 (GRCm38)	L618P	probably damaging	Het
Cfap65	T	C	1: 74,918,444 (GRCm38)	T989A	probably benign	Het
Cnpy4	T	C	5: 138,187,637 (GRCm38)	F18S	possibly damaging	Het
Col6a5	A	G	9: 105,904,579 (GRCm38)		probably benign	Het
Dppa2	G	A	16: 48,318,671 (GRCm38)	R289H	probably benign	Het
Evx2	T	C	2: 74,659,134 (GRCm38)	T96A	probably benign	Het
Frmd4a	A	G	2: 4,603,967 (GRCm38)	E577G	possibly damaging	Het
Gcgr	G	A	11: 120,536,561 (GRCm38)	G166S	probably benign	Het
Gm4788	A	T	1: 139,739,488 (GRCm38)	D377E	probably damaging	Het
Gm5316	T	C	6: 122,900,191 (GRCm38)		noncoding transcript	Het
Gria1	G	A	11: 57,228,973 (GRCm38)	R292Q	probably damaging	Het
Hars2	T	A	18: 36,786,208 (GRCm38)		probably null	Het
Hkdc1	T	A	10: 62,400,240 (GRCm38)	T508S	probably benign	Het
Kif2b	A	T	11: 91,576,584 (GRCm38)	I291N	probably damaging	Het
Lmbrd1	A	T	1: 24,744,920 (GRCm38)	T377S	probably benign	Het
Lrrc28	A	G	7: 67,628,342 (GRCm38)		probably benign	Het
Mmp3	A	T	9: 7,455,638 (GRCm38)	N463I	probably benign	Het
Myh6	A	G	14: 54,958,608 (GRCm38)	F578S	probably damaging	Het
Ncbp1	T	A	4: 46,168,476 (GRCm38)	M608K	possibly damaging	Het
Nf1	T	C	11: 79,468,771 (GRCm38)	F1412L	probably damaging	Het
Nlrp5	T	A	7: 23,441,802 (GRCm38)	W1083R	probably damaging	Het
Nrsn1	T	C	13: 25,262,258 (GRCm38)	Y45C	probably benign	Het
Olfr401	T	G	11: 74,121,475 (GRCm38)	M62R	probably damaging	Het
Osbpl7	G	T	11: 97,067,542 (GRCm38)	R881L	probably damaging	Het
Papss1	A	G	3: 131,619,213 (GRCm38)	E456G	possibly damaging	Het
Pbxip1	T	A	3: 89,443,592 (GRCm38)		probably benign	Het
Pcca	A	G	14: 122,638,377 (GRCm38)		probably benign	Het
Pde1a	T	A	2: 79,865,070 (GRCm38)	N511I	probably damaging	Het
Prpf39	A	T	12: 65,056,256 (GRCm38)	I435F	probably benign	Het
Sel1l2	A	T	2: 140,265,882 (GRCm38)	M216K	probably damaging	Het
Sidt2	A	G	9: 45,953,119 (GRCm38)		probably null	Het
Sirt3	A	T	7: 140,869,487 (GRCm38)		probably null	Het
Smpd4	T	C	16: 17,639,312 (GRCm38)	V378A	probably benign	Het
Svil	T	A	18: 5,064,566 (GRCm38)	S642T	possibly damaging	Het
Tcp10a	A	G	17: 7,326,551 (GRCm38)	K92E	probably benign	Het
Tmem144	T	C	3: 79,822,744 (GRCm38)	D233G	probably damaging	Het
Tnfrsf21	C	T	17: 43,038,213 (GRCm38)	H239Y	probably benign	Het
Tnik	T	C	3: 28,570,920 (GRCm38)	S335P	possibly damaging	Het
Ush2a	T	C	1: 188,946,953 (GRCm38)	L4786P	probably damaging	Het
Utp11	A	T	4: 124,686,079 (GRCm38)		probably benign	Het
Vmn1r67	A	G	7: 10,447,714 (GRCm38)	N241D	probably damaging	Het
Vmn2r11	A	T	5: 109,052,097 (GRCm38)	C497S	possibly damaging	Het

Other mutations in Rnf213

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Rnf213	APN	11	119,449,343 (GRCm38)	missense	probably benign	0.00
IGL00961:Rnf213	APN	11	119,440,843 (GRCm38)	missense	possibly damaging	0.55
IGL01324:Rnf213	APN	11	119,447,237 (GRCm38)	missense	probably damaging	1.00
IGL01351:Rnf213	APN	11	119,483,118 (GRCm38)	missense	probably benign	0.25
IGL01403:Rnf213	APN	11	119,443,300 (GRCm38)	missense	probably damaging	1.00
IGL01704:Rnf213	APN	11	119,449,876 (GRCm38)	critical splice donor site	probably null
IGL01765:Rnf213	APN	11	119,436,352 (GRCm38)	missense	probably benign	0.00
IGL01803:Rnf213	APN	11	119,441,307 (GRCm38)	missense	probably damaging	1.00
IGL01804:Rnf213	APN	11	119,442,266 (GRCm38)	missense	probably damaging	1.00
IGL01900:Rnf213	APN	11	119,443,015 (GRCm38)	missense	probably benign	0.05
IGL01944:Rnf213	APN	11	119,416,457 (GRCm38)	missense	probably benign	0.01
IGL01982:Rnf213	APN	11	119,443,268 (GRCm38)	missense	probably damaging	1.00
IGL02008:Rnf213	APN	11	119,418,309 (GRCm38)	splice site	probably benign
IGL02084:Rnf213	APN	11	119,445,673 (GRCm38)	missense	probably benign	0.04
IGL02253:Rnf213	APN	11	119,440,650 (GRCm38)	missense	probably benign	0.03
IGL02254:Rnf213	APN	11	119,480,907 (GRCm38)	missense	possibly damaging	0.89
IGL02296:Rnf213	APN	11	119,463,336 (GRCm38)	missense	probably benign	0.01
IGL02531:Rnf213	APN	11	119,436,802 (GRCm38)	missense	probably benign
IGL02588:Rnf213	APN	11	119,416,536 (GRCm38)	missense	probably benign	0.30
IGL02615:Rnf213	APN	11	119,440,789 (GRCm38)	missense	probably damaging	0.96
IGL02805:Rnf213	APN	11	119,435,066 (GRCm38)	missense	probably damaging	0.99
IGL02887:Rnf213	APN	11	119,427,510 (GRCm38)	missense	probably damaging	1.00
IGL03001:Rnf213	APN	11	119,479,941 (GRCm38)	missense	probably damaging	1.00
IGL03035:Rnf213	APN	11	119,445,626 (GRCm38)	splice site	probably benign
IGL03057:Rnf213	APN	11	119,441,087 (GRCm38)	missense	probably damaging	1.00
IGL03148:Rnf213	APN	11	119,465,007 (GRCm38)	missense	probably damaging	1.00
IGL03308:Rnf213	APN	11	119,474,172 (GRCm38)	missense	probably benign	0.03
IGL03339:Rnf213	APN	11	119,443,004 (GRCm38)	missense	probably damaging	1.00
IGL03369:Rnf213	APN	11	119,421,468 (GRCm38)	missense	probably benign	0.34
attrition	UTSW	11	119,430,321 (GRCm38)	missense	possibly damaging	0.77
defame	UTSW	11	119,430,281 (GRCm38)	nonsense	probably null
Derogate	UTSW	11	119,470,210 (GRCm38)	missense	probably damaging	1.00
dinky	UTSW	11	119,416,458 (GRCm38)	missense	probably damaging	0.99
G1funyon_rnf213_024	UTSW	11	119,434,742 (GRCm38)	missense
Impugn	UTSW	11	119,436,823 (GRCm38)	nonsense	probably null
R4332_Rnf213_642	UTSW	11	119,436,676 (GRCm38)	missense	probably damaging	1.00
B6584:Rnf213	UTSW	11	119,426,069 (GRCm38)	missense	probably damaging	0.97
G1Funyon:Rnf213	UTSW	11	119,434,742 (GRCm38)	missense
PIT4585001:Rnf213	UTSW	11	119,458,392 (GRCm38)	missense
R0008:Rnf213	UTSW	11	119,465,052 (GRCm38)	missense	possibly damaging	0.82
R0015:Rnf213	UTSW	11	119,441,606 (GRCm38)	missense	possibly damaging	0.95
R0041:Rnf213	UTSW	11	119,402,575 (GRCm38)	missense	probably benign	0.41
R0114:Rnf213	UTSW	11	119,414,587 (GRCm38)	missense	probably damaging	1.00
R0131:Rnf213	UTSW	11	119,430,361 (GRCm38)	missense	probably benign	0.10
R0131:Rnf213	UTSW	11	119,430,361 (GRCm38)	missense	probably benign	0.10
R0132:Rnf213	UTSW	11	119,430,361 (GRCm38)	missense	probably benign	0.10
R0138:Rnf213	UTSW	11	119,416,496 (GRCm38)	missense	probably benign	0.05
R0144:Rnf213	UTSW	11	119,479,600 (GRCm38)	nonsense	probably null
R0184:Rnf213	UTSW	11	119,414,521 (GRCm38)	missense	probably damaging	0.99
R0321:Rnf213	UTSW	11	119,438,105 (GRCm38)	nonsense	probably null
R0365:Rnf213	UTSW	11	119,426,111 (GRCm38)	missense	possibly damaging	0.74
R0415:Rnf213	UTSW	11	119,414,469 (GRCm38)	missense	probably damaging	1.00
R0421:Rnf213	UTSW	11	119,447,257 (GRCm38)	missense	probably damaging	1.00
R0494:Rnf213	UTSW	11	119,426,012 (GRCm38)	missense	possibly damaging	0.65
R0494:Rnf213	UTSW	11	119,443,120 (GRCm38)	missense	probably damaging	1.00
R0577:Rnf213	UTSW	11	119,443,280 (GRCm38)	missense	probably damaging	1.00
R0605:Rnf213	UTSW	11	119,431,717 (GRCm38)	missense	probably benign	0.03
R0638:Rnf213	UTSW	11	119,470,210 (GRCm38)	missense	probably damaging	1.00
R0675:Rnf213	UTSW	11	119,441,834 (GRCm38)	missense	probably benign	0.28
R0715:Rnf213	UTSW	11	119,441,150 (GRCm38)	missense	probably damaging	0.97
R0732:Rnf213	UTSW	11	119,441,068 (GRCm38)	missense	probably damaging	0.99
R0748:Rnf213	UTSW	11	119,473,480 (GRCm38)	missense	probably damaging	1.00
R0765:Rnf213	UTSW	11	119,423,095 (GRCm38)	critical splice donor site	probably null
R0890:Rnf213	UTSW	11	119,430,486 (GRCm38)	missense	possibly damaging	0.94
R0927:Rnf213	UTSW	11	119,414,570 (GRCm38)	missense	probably benign	0.00
R0940:Rnf213	UTSW	11	119,416,563 (GRCm38)	missense	probably benign	0.10
R0959:Rnf213	UTSW	11	119,452,581 (GRCm38)	missense	probably damaging	0.99
R1077:Rnf213	UTSW	11	119,485,998 (GRCm38)	splice site	probably benign
R1104:Rnf213	UTSW	11	119,477,229 (GRCm38)	missense	probably benign	0.29
R1141:Rnf213	UTSW	11	119,435,983 (GRCm38)	missense	probably benign	0.02
R1219:Rnf213	UTSW	11	119,436,177 (GRCm38)	missense	probably damaging	1.00
R1435:Rnf213	UTSW	11	119,436,005 (GRCm38)	missense	probably damaging	1.00
R1444:Rnf213	UTSW	11	119,442,400 (GRCm38)	missense	probably damaging	1.00
R1474:Rnf213	UTSW	11	119,437,750 (GRCm38)	missense	probably damaging	1.00
R1488:Rnf213	UTSW	11	119,480,889 (GRCm38)	missense	probably benign	0.05
R1523:Rnf213	UTSW	11	119,441,888 (GRCm38)	missense	probably damaging	1.00
R1548:Rnf213	UTSW	11	119,442,707 (GRCm38)	missense	probably damaging	1.00
R1554:Rnf213	UTSW	11	119,441,839 (GRCm38)	missense	probably benign	0.06
R1563:Rnf213	UTSW	11	119,414,526 (GRCm38)	missense	probably benign	0.13
R1572:Rnf213	UTSW	11	119,436,611 (GRCm38)	missense	probably damaging	1.00
R1585:Rnf213	UTSW	11	119,463,345 (GRCm38)	missense	probably damaging	1.00
R1635:Rnf213	UTSW	11	119,442,579 (GRCm38)	missense	probably damaging	0.97
R1663:Rnf213	UTSW	11	119,437,672 (GRCm38)	missense	probably benign	0.01
R1789:Rnf213	UTSW	11	119,440,221 (GRCm38)	missense	probably damaging	0.97
R1844:Rnf213	UTSW	11	119,441,183 (GRCm38)	missense	probably damaging	1.00
R1871:Rnf213	UTSW	11	119,450,129 (GRCm38)	missense	probably benign	0.08
R1893:Rnf213	UTSW	11	119,416,448 (GRCm38)	missense	probably damaging	1.00
R1937:Rnf213	UTSW	11	119,431,685 (GRCm38)	missense	probably damaging	1.00
R1967:Rnf213	UTSW	11	119,480,895 (GRCm38)	missense	probably damaging	1.00
R1987:Rnf213	UTSW	11	119,441,107 (GRCm38)	missense	probably damaging	1.00
R2000:Rnf213	UTSW	11	119,436,022 (GRCm38)	missense	probably damaging	1.00
R2020:Rnf213	UTSW	11	119,461,918 (GRCm38)	missense	probably damaging	0.99
R2100:Rnf213	UTSW	11	119,467,302 (GRCm38)	nonsense	probably null
R2109:Rnf213	UTSW	11	119,442,663 (GRCm38)	nonsense	probably null
R2115:Rnf213	UTSW	11	119,428,013 (GRCm38)	missense	probably benign	0.00
R2126:Rnf213	UTSW	11	119,450,201 (GRCm38)	missense	probably damaging	0.99
R2144:Rnf213	UTSW	11	119,443,690 (GRCm38)	missense	probably damaging	0.99
R2145:Rnf213	UTSW	11	119,415,193 (GRCm38)	missense	probably benign	0.03
R2168:Rnf213	UTSW	11	119,415,070 (GRCm38)	missense	probably damaging	0.97
R2189:Rnf213	UTSW	11	119,430,361 (GRCm38)	missense	probably benign	0.10
R2199:Rnf213	UTSW	11	119,460,009 (GRCm38)	missense	probably benign	0.01
R2220:Rnf213	UTSW	11	119,436,428 (GRCm38)	missense	possibly damaging	0.94
R2336:Rnf213	UTSW	11	119,414,604 (GRCm38)	missense	probably benign	0.02
R2400:Rnf213	UTSW	11	119,443,195 (GRCm38)	missense	probably damaging	1.00
R2679:Rnf213	UTSW	11	119,459,938 (GRCm38)	splice site	probably null
R2698:Rnf213	UTSW	11	119,410,144 (GRCm38)	missense	probably benign	0.26
R3151:Rnf213	UTSW	11	119,468,892 (GRCm38)	missense	probably benign	0.03
R3607:Rnf213	UTSW	11	119,441,976 (GRCm38)	nonsense	probably null
R3808:Rnf213	UTSW	11	119,479,558 (GRCm38)	missense	probably damaging	1.00
R3854:Rnf213	UTSW	11	119,480,939 (GRCm38)	splice site	probably benign
R3856:Rnf213	UTSW	11	119,480,939 (GRCm38)	splice site	probably benign
R3973:Rnf213	UTSW	11	119,469,053 (GRCm38)	missense
R4014:Rnf213	UTSW	11	119,445,729 (GRCm38)	nonsense	probably null
R4049:Rnf213	UTSW	11	119,482,448 (GRCm38)	missense	possibly damaging	0.67
R4130:Rnf213	UTSW	11	119,483,006 (GRCm38)	missense	probably damaging	1.00
R4153:Rnf213	UTSW	11	119,409,482 (GRCm38)	missense	probably benign	0.27
R4167:Rnf213	UTSW	11	119,441,243 (GRCm38)	missense	probably damaging	0.99
R4224:Rnf213	UTSW	11	119,436,823 (GRCm38)	nonsense	probably null
R4332:Rnf213	UTSW	11	119,436,676 (GRCm38)	missense	probably damaging	1.00
R4415:Rnf213	UTSW	11	119,483,964 (GRCm38)	missense	probably damaging	0.99
R4547:Rnf213	UTSW	11	119,479,670 (GRCm38)	critical splice donor site	probably null
R4609:Rnf213	UTSW	11	119,437,695 (GRCm38)	missense	possibly damaging	0.86
R4684:Rnf213	UTSW	11	119,441,125 (GRCm38)	missense	probably damaging	1.00
R4704:Rnf213	UTSW	11	119,440,349 (GRCm38)	missense	probably damaging	1.00
R4719:Rnf213	UTSW	11	119,420,067 (GRCm38)	missense	probably benign	0.38
R4751:Rnf213	UTSW	11	119,445,745 (GRCm38)	missense	probably benign	0.12
R4828:Rnf213	UTSW	11	119,416,629 (GRCm38)	missense	possibly damaging	0.61
R4837:Rnf213	UTSW	11	119,442,763 (GRCm38)	missense	probably benign	0.00
R4894:Rnf213	UTSW	11	119,481,240 (GRCm38)	missense	probably damaging	1.00
R4973:Rnf213	UTSW	11	119,428,157 (GRCm38)	missense	possibly damaging	0.84
R5026:Rnf213	UTSW	11	119,436,764 (GRCm38)	missense	probably damaging	1.00
R5034:Rnf213	UTSW	11	119,410,807 (GRCm38)	missense	probably damaging	0.99
R5284:Rnf213	UTSW	11	119,458,866 (GRCm38)	missense	possibly damaging	0.89
R5295:Rnf213	UTSW	11	119,440,816 (GRCm38)	missense	probably benign	0.00
R5406:Rnf213	UTSW	11	119,440,808 (GRCm38)	missense	probably damaging	1.00
R5441:Rnf213	UTSW	11	119,409,020 (GRCm38)	missense	probably damaging	0.99
R5449:Rnf213	UTSW	11	119,415,076 (GRCm38)	missense	probably benign	0.44
R5520:Rnf213	UTSW	11	119,433,499 (GRCm38)	missense	probably damaging	1.00
R5636:Rnf213	UTSW	11	119,436,905 (GRCm38)	missense	probably damaging	1.00
R5636:Rnf213	UTSW	11	119,436,629 (GRCm38)	missense	probably benign	0.04
R5669:Rnf213	UTSW	11	119,458,785 (GRCm38)	missense	possibly damaging	0.92
R5670:Rnf213	UTSW	11	119,434,686 (GRCm38)	critical splice acceptor site	probably null
R5697:Rnf213	UTSW	11	119,483,894 (GRCm38)	missense	possibly damaging	0.54
R5726:Rnf213	UTSW	11	119,416,458 (GRCm38)	missense	probably damaging	0.99
R5808:Rnf213	UTSW	11	119,436,295 (GRCm38)	missense	probably benign
R5861:Rnf213	UTSW	11	119,473,377 (GRCm38)	missense	probably damaging	1.00
R5903:Rnf213	UTSW	11	119,421,369 (GRCm38)	missense	probably damaging	0.98
R5949:Rnf213	UTSW	11	119,443,079 (GRCm38)	missense	probably damaging	1.00
R6022:Rnf213	UTSW	11	119,486,010 (GRCm38)	missense	probably benign	0.00
R6043:Rnf213	UTSW	11	119,442,101 (GRCm38)	missense	probably damaging	0.97
R6089:Rnf213	UTSW	11	119,416,559 (GRCm38)	missense	probably benign	0.14
R6123:Rnf213	UTSW	11	119,411,513 (GRCm38)	missense	probably damaging	0.96
R6134:Rnf213	UTSW	11	119,411,470 (GRCm38)	missense	probably damaging	0.99
R6135:Rnf213	UTSW	11	119,442,028 (GRCm38)	missense	probably benign	0.02
R6146:Rnf213	UTSW	11	119,435,999 (GRCm38)	missense	probably benign	0.41
R6163:Rnf213	UTSW	11	119,458,428 (GRCm38)	missense	possibly damaging	0.86
R6272:Rnf213	UTSW	11	119,414,548 (GRCm38)	missense	probably damaging	1.00
R6333:Rnf213	UTSW	11	119,463,366 (GRCm38)	missense	probably damaging	1.00
R6370:Rnf213	UTSW	11	119,477,078 (GRCm38)	missense	probably damaging	0.99
R6456:Rnf213	UTSW	11	119,459,966 (GRCm38)	missense	probably benign	0.03
R6468:Rnf213	UTSW	11	119,452,687 (GRCm38)	missense	possibly damaging	0.94
R6579:Rnf213	UTSW	11	119,436,280 (GRCm38)	missense	probably damaging	0.96
R6648:Rnf213	UTSW	11	119,479,920 (GRCm38)	missense	possibly damaging	0.81
R6727:Rnf213	UTSW	11	119,430,321 (GRCm38)	missense	possibly damaging	0.77
R6739:Rnf213	UTSW	11	119,442,271 (GRCm38)	missense	probably damaging	1.00
R6768:Rnf213	UTSW	11	119,442,236 (GRCm38)	missense	probably damaging	0.99
R6817:Rnf213	UTSW	11	119,462,285 (GRCm38)	critical splice donor site	probably null
R6820:Rnf213	UTSW	11	119,448,838 (GRCm38)	missense	probably damaging	1.00
R6841:Rnf213	UTSW	11	119,449,866 (GRCm38)	missense	probably benign	0.26
R6934:Rnf213	UTSW	11	119,420,067 (GRCm38)	missense	probably benign	0.38
R7026:Rnf213	UTSW	11	119,479,655 (GRCm38)	missense	possibly damaging	0.58
R7094:Rnf213	UTSW	11	119,437,604 (GRCm38)	splice site	probably null
R7170:Rnf213	UTSW	11	119,452,575 (GRCm38)	missense
R7185:Rnf213	UTSW	11	119,424,198 (GRCm38)	missense
R7239:Rnf213	UTSW	11	119,458,788 (GRCm38)	missense
R7258:Rnf213	UTSW	11	119,452,575 (GRCm38)	missense
R7259:Rnf213	UTSW	11	119,452,575 (GRCm38)	missense
R7260:Rnf213	UTSW	11	119,452,575 (GRCm38)	missense
R7273:Rnf213	UTSW	11	119,431,756 (GRCm38)	splice site	probably null
R7282:Rnf213	UTSW	11	119,437,992 (GRCm38)	missense
R7311:Rnf213	UTSW	11	119,416,547 (GRCm38)	missense
R7352:Rnf213	UTSW	11	119,443,579 (GRCm38)	missense
R7369:Rnf213	UTSW	11	119,430,468 (GRCm38)	missense
R7410:Rnf213	UTSW	11	119,435,051 (GRCm38)	missense
R7448:Rnf213	UTSW	11	119,481,291 (GRCm38)	missense
R7561:Rnf213	UTSW	11	119,441,719 (GRCm38)	missense
R7573:Rnf213	UTSW	11	119,458,484 (GRCm38)	missense
R7615:Rnf213	UTSW	11	119,467,297 (GRCm38)	missense
R7680:Rnf213	UTSW	11	119,479,556 (GRCm38)	missense
R7739:Rnf213	UTSW	11	119,410,861 (GRCm38)	missense
R7789:Rnf213	UTSW	11	119,470,219 (GRCm38)	splice site	probably null
R7806:Rnf213	UTSW	11	119,411,545 (GRCm38)	missense
R8031:Rnf213	UTSW	11	119,430,281 (GRCm38)	nonsense	probably null
R8042:Rnf213	UTSW	11	119,441,654 (GRCm38)	missense
R8053:Rnf213	UTSW	11	119,402,647 (GRCm38)	missense
R8284:Rnf213	UTSW	11	119,428,083 (GRCm38)	missense
R8301:Rnf213	UTSW	11	119,434,742 (GRCm38)	missense
R8325:Rnf213	UTSW	11	119,430,445 (GRCm38)	missense
R8332:Rnf213	UTSW	11	119,483,698 (GRCm38)	missense
R8443:Rnf213	UTSW	11	119,449,323 (GRCm38)	missense
R8518:Rnf213	UTSW	11	119,462,217 (GRCm38)	missense
R8531:Rnf213	UTSW	11	119,474,205 (GRCm38)	missense	probably benign	0.02
R8670:Rnf213	UTSW	11	119,458,737 (GRCm38)	missense
R8675:Rnf213	UTSW	11	119,456,158 (GRCm38)	missense
R8690:Rnf213	UTSW	11	119,441,212 (GRCm38)	missense
R8690:Rnf213	UTSW	11	119,418,129 (GRCm38)	missense
R8714:Rnf213	UTSW	11	119,468,894 (GRCm38)	missense
R8802:Rnf213	UTSW	11	119,462,102 (GRCm38)	missense
R8861:Rnf213	UTSW	11	119,442,236 (GRCm38)	missense
R8886:Rnf213	UTSW	11	119,473,438 (GRCm38)	missense
R8893:Rnf213	UTSW	11	119,443,042 (GRCm38)	missense
R8937:Rnf213	UTSW	11	119,430,274 (GRCm38)	missense	possibly damaging	0.94
R8941:Rnf213	UTSW	11	119,414,424 (GRCm38)	missense	probably damaging	1.00
R8973:Rnf213	UTSW	11	119,461,930 (GRCm38)	missense
R8983:Rnf213	UTSW	11	119,430,349 (GRCm38)	missense
R9043:Rnf213	UTSW	11	119,458,913 (GRCm38)	missense
R9081:Rnf213	UTSW	11	119,466,236 (GRCm38)	missense
R9132:Rnf213	UTSW	11	119,483,916 (GRCm38)	missense
R9135:Rnf213	UTSW	11	119,408,747 (GRCm38)	missense
R9146:Rnf213	UTSW	11	119,443,673 (GRCm38)	missense
R9156:Rnf213	UTSW	11	119,440,748 (GRCm38)	missense
R9183:Rnf213	UTSW	11	119,427,622 (GRCm38)	missense
R9234:Rnf213	UTSW	11	119,450,117 (GRCm38)	missense
R9275:Rnf213	UTSW	11	119,435,942 (GRCm38)	missense
R9278:Rnf213	UTSW	11	119,435,942 (GRCm38)	missense
R9296:Rnf213	UTSW	11	119,443,795 (GRCm38)	splice site	probably benign
R9350:Rnf213	UTSW	11	119,442,149 (GRCm38)	missense
R9366:Rnf213	UTSW	11	119,436,231 (GRCm38)	missense
R9413:Rnf213	UTSW	11	119,466,233 (GRCm38)	missense
R9444:Rnf213	UTSW	11	119,434,797 (GRCm38)	missense
R9464:Rnf213	UTSW	11	119,463,580 (GRCm38)	missense
R9605:Rnf213	UTSW	11	119,469,053 (GRCm38)	missense
R9649:Rnf213	UTSW	11	119,479,631 (GRCm38)	missense
R9651:Rnf213	UTSW	11	119,440,412 (GRCm38)	missense
R9664:Rnf213	UTSW	11	119,441,968 (GRCm38)	missense
R9696:Rnf213	UTSW	11	119,468,980 (GRCm38)	missense
R9710:Rnf213	UTSW	11	119,441,005 (GRCm38)	missense
R9797:Rnf213	UTSW	11	119,442,539 (GRCm38)	missense
S24628:Rnf213	UTSW	11	119,414,469 (GRCm38)	missense	probably damaging	1.00
X0021:Rnf213	UTSW	11	119,441,824 (GRCm38)	missense	probably benign	0.14
X0062:Rnf213	UTSW	11	119,473,513 (GRCm38)	missense	probably benign	0.05
X0064:Rnf213	UTSW	11	119,440,463 (GRCm38)	missense	probably damaging	1.00
Z1088:Rnf213	UTSW	11	119,477,254 (GRCm38)	missense	possibly damaging	0.69
Z1176:Rnf213	UTSW	11	119,482,998 (GRCm38)	missense
Z1176:Rnf213	UTSW	11	119,441,410 (GRCm38)	missense

Predicted Primers

PCR Primer
(F):5'- GACCAGTCATGTGTGTCAGATCCAG -3'
(R):5'- AACCACTGCCAATTCTGTGCCG -3'

Sequencing Primer
(F):5'- GTGTCAGATCCAGGTGCTG -3'
(R):5'- tgtttgtttgttttctttgtttttCC -3'

Posted On

2013-06-11