Incidental Mutation 'R5840:Trpm7'
ID450357
Institutional Source Beutler Lab
Gene Symbol Trpm7
Ensembl Gene ENSMUSG00000027365
Gene Nametransient receptor potential cation channel, subfamily M, member 7
SynonymsLTRPC7, 2310022G15Rik, CHAK, CHAK1, Ltpr7, 4833414K03Rik, 5033407O22Rik, TRP-PLIK
MMRRC Submission 044060-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5840 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location126791565-126876230 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 126822611 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 949 (Y949*)
Ref Sequence ENSEMBL: ENSMUSP00000099513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028843] [ENSMUST00000103224]
PDB Structure
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (AMPPNP COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (ADP-MG COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (APO) [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000028843
AA Change: Y949*
SMART Domains Protein: ENSMUSP00000028843
Gene: ENSMUSG00000027365
AA Change: Y949*

DomainStartEndE-ValueType
Blast:ANK 438 467 5e-6 BLAST
low complexity region 541 555 N/A INTRINSIC
transmembrane domain 757 774 N/A INTRINSIC
transmembrane domain 853 875 N/A INTRINSIC
Pfam:Ion_trans 887 1096 3e-8 PFAM
PDB:3E7K|H 1198 1249 6e-27 PDB
low complexity region 1385 1397 N/A INTRINSIC
Blast:Alpha_kinase 1398 1545 6e-64 BLAST
Alpha_kinase 1596 1813 3.77e-89 SMART
Predicted Effect probably null
Transcript: ENSMUST00000103224
AA Change: Y949*
SMART Domains Protein: ENSMUSP00000099513
Gene: ENSMUSG00000027365
AA Change: Y949*

DomainStartEndE-ValueType
Blast:ANK 438 467 5e-6 BLAST
low complexity region 541 555 N/A INTRINSIC
transmembrane domain 757 774 N/A INTRINSIC
Pfam:Ion_trans 855 1108 1.7e-9 PFAM
Pfam:TRPM_tetra 1194 1249 3.3e-29 PFAM
low complexity region 1385 1397 N/A INTRINSIC
Blast:Alpha_kinase 1398 1546 2e-64 BLAST
Alpha_kinase 1597 1814 3.77e-89 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142334
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 96.5%
  • 20x: 88.1%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is both an ion channel and a serine/threonine protein kinase. The kinase activity is essential for the ion channel function, which serves to increase intracellular calcium levels and to help regulate magnesium ion homeostasis. Defects in this gene are a cause of amyotrophic lateral sclerosis-parkinsonism/dementia complex of Guam. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele display embryonic lehality. Mice with conditional deletion in developing thymocytes display a block in thymopoiesis. Mice homozygous for a kinase deleted allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit altered magnesium homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G A 2: 25,433,359 R113Q probably benign Het
Aip G A 19: 4,116,010 P147L possibly damaging Het
Anapc1 A C 2: 128,607,037 probably benign Het
Arhgap42 C T 9: 9,046,517 V240I possibly damaging Het
Axdnd1 T C 1: 156,348,958 E684G probably damaging Het
BC005624 G A 2: 30,981,857 R2W probably benign Het
Cd177 T G 7: 24,758,070 Q182P probably damaging Het
Cdca5 G A 19: 6,090,369 E187K possibly damaging Het
Chmp1a T C 8: 123,208,100 Q39R probably benign Het
Dab2ip A G 2: 35,727,499 I1079V probably damaging Het
Dip2c A T 13: 9,506,676 E85D possibly damaging Het
Elmo2 A T 2: 165,295,552 S497R possibly damaging Het
Ephb6 C T 6: 41,615,573 A339V possibly damaging Het
Foxred1 T C 9: 35,210,139 K38E probably damaging Het
Frem2 T A 3: 53,647,921 T1732S probably damaging Het
Fto A G 8: 91,666,440 probably benign Het
Gm17430 T A 18: 9,726,528 Q48L probably damaging Het
Gng2 A G 14: 19,875,814 I70T probably damaging Het
Gtf2a2 A G 9: 70,015,293 probably benign Het
Invs A G 4: 48,396,284 D263G probably damaging Het
Itga2b C T 11: 102,461,331 V475M probably damaging Het
Kansl1l A G 1: 66,770,215 probably benign Het
Klhl25 T C 7: 75,866,692 F449L possibly damaging Het
Lamb1 T A 12: 31,266,756 C83S probably damaging Het
Loxl4 G T 19: 42,598,715 T648K probably damaging Het
Lrit2 T C 14: 37,069,005 F214L possibly damaging Het
N4bp2 T G 5: 65,808,094 L1162R probably damaging Het
Naa40 A T 19: 7,230,008 I117N probably benign Het
Ncapd3 T C 9: 27,094,758 S1492P probably benign Het
Nf2 T A 11: 4,816,146 D128V probably benign Het
Nox4 T C 7: 87,360,793 S401P probably benign Het
Nt5c1b T C 12: 10,377,171 V323A probably damaging Het
Olfr1474 G A 19: 13,471,878 V303I probably benign Het
Olfr601 T A 7: 103,358,369 H275L probably damaging Het
Olfr622 C T 7: 103,639,256 V295I probably benign Het
Pcdhb14 T C 18: 37,448,750 V303A probably benign Het
Pde8a C A 7: 81,213,965 H17Q probably benign Het
Pfkl C T 10: 77,988,724 V716I probably benign Het
Phc3 G A 3: 30,936,583 S495L possibly damaging Het
Psg18 A G 7: 18,346,602 probably benign Het
Rcc2 T G 4: 140,712,138 N175K possibly damaging Het
Rhot2 G A 17: 25,840,058 T276I probably benign Het
Rnase9 A T 14: 51,038,988 Y178N probably benign Het
Sema4b T C 7: 80,218,949 C297R probably damaging Het
Slc35d2 T C 13: 64,118,413 probably null Het
Sptlc3 A T 2: 139,547,206 N169Y probably damaging Het
Srsf9 T G 5: 115,331,465 M29R probably benign Het
Stip1 C A 19: 7,022,068 D449Y possibly damaging Het
Syne2 T A 12: 75,880,291 probably null Het
Tgm5 A G 2: 121,085,660 probably null Het
Thbs2 A T 17: 14,681,430 probably null Het
Trak2 T C 1: 58,919,273 E283G probably damaging Het
Trbv21 A G 6: 41,202,858 Y36C probably damaging Het
Ubqln5 T C 7: 104,128,954 D221G possibly damaging Het
Ubxn4 T A 1: 128,259,525 V85D possibly damaging Het
Vmn1r172 T A 7: 23,660,175 W162R probably benign Het
Vrk2 A G 11: 26,534,314 probably benign Het
Zc3h8 A C 2: 128,929,904 D276E probably benign Het
Zfp369 C T 13: 65,297,278 T745I possibly damaging Het
Zfp608 T C 18: 54,898,906 K654R probably damaging Het
Other mutations in Trpm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Trpm7 APN 2 126829031 missense possibly damaging 0.82
IGL01084:Trpm7 APN 2 126846072 critical splice donor site probably null
IGL01634:Trpm7 APN 2 126826818 missense probably damaging 1.00
IGL01678:Trpm7 APN 2 126816799 missense probably damaging 0.99
IGL02005:Trpm7 APN 2 126813184 missense probably damaging 0.97
IGL02064:Trpm7 APN 2 126797943 missense probably damaging 1.00
IGL02156:Trpm7 APN 2 126799243 unclassified probably benign
IGL02172:Trpm7 APN 2 126795328 missense possibly damaging 0.94
IGL02334:Trpm7 APN 2 126807362 missense probably benign
IGL02375:Trpm7 APN 2 126825744 missense probably damaging 1.00
IGL02388:Trpm7 APN 2 126819891 missense possibly damaging 0.80
IGL02552:Trpm7 APN 2 126840779 missense probably damaging 1.00
IGL02684:Trpm7 APN 2 126846159 missense probably damaging 0.99
IGL02901:Trpm7 APN 2 126807287 critical splice donor site probably null
Accused UTSW 2 126826737 missense probably damaging 0.99
Condemned UTSW 2 126835508 missense probably damaging 1.00
P0037:Trpm7 UTSW 2 126816757 splice site probably benign
R0038:Trpm7 UTSW 2 126795468 missense probably damaging 1.00
R0139:Trpm7 UTSW 2 126812771 missense probably benign
R0165:Trpm7 UTSW 2 126797513 missense probably damaging 0.97
R0511:Trpm7 UTSW 2 126826718 nonsense probably null
R0543:Trpm7 UTSW 2 126848529 missense probably damaging 1.00
R0784:Trpm7 UTSW 2 126846072 critical splice donor site probably null
R0844:Trpm7 UTSW 2 126835508 missense probably damaging 1.00
R0865:Trpm7 UTSW 2 126799239 unclassified probably null
R0919:Trpm7 UTSW 2 126831238 missense probably damaging 1.00
R0972:Trpm7 UTSW 2 126805049 missense probably benign
R1109:Trpm7 UTSW 2 126797793 missense probably benign 0.01
R1118:Trpm7 UTSW 2 126822486 missense possibly damaging 0.63
R1278:Trpm7 UTSW 2 126825454 nonsense probably null
R1527:Trpm7 UTSW 2 126830162 missense probably benign 0.18
R1542:Trpm7 UTSW 2 126822599 nonsense probably null
R1882:Trpm7 UTSW 2 126812777 missense probably benign 0.00
R1951:Trpm7 UTSW 2 126831299 missense probably damaging 1.00
R2011:Trpm7 UTSW 2 126823997 nonsense probably null
R2012:Trpm7 UTSW 2 126823997 nonsense probably null
R2026:Trpm7 UTSW 2 126812738 missense probably benign 0.39
R2067:Trpm7 UTSW 2 126797727 missense probably damaging 1.00
R2926:Trpm7 UTSW 2 126858409 splice site probably benign
R3082:Trpm7 UTSW 2 126844422 missense possibly damaging 0.90
R3552:Trpm7 UTSW 2 126826710 splice site probably benign
R3607:Trpm7 UTSW 2 126796428 intron probably benign
R3739:Trpm7 UTSW 2 126851521 missense probably damaging 1.00
R3943:Trpm7 UTSW 2 126831218 missense possibly damaging 0.94
R4161:Trpm7 UTSW 2 126816831 missense probably damaging 1.00
R4176:Trpm7 UTSW 2 126829163 missense possibly damaging 0.83
R4392:Trpm7 UTSW 2 126795509 splice site probably null
R4392:Trpm7 UTSW 2 126848538 missense probably damaging 1.00
R4404:Trpm7 UTSW 2 126833715 missense probably damaging 0.97
R4574:Trpm7 UTSW 2 126797211 missense probably benign 0.01
R4714:Trpm7 UTSW 2 126840783 nonsense probably null
R4807:Trpm7 UTSW 2 126831229 missense probably benign 0.00
R4815:Trpm7 UTSW 2 126858492 missense probably damaging 1.00
R4846:Trpm7 UTSW 2 126813185 missense possibly damaging 0.63
R4972:Trpm7 UTSW 2 126824058 missense probably damaging 1.00
R5097:Trpm7 UTSW 2 126796336 critical splice donor site probably null
R5263:Trpm7 UTSW 2 126821217 missense probably benign 0.34
R5361:Trpm7 UTSW 2 126829241 missense possibly damaging 0.77
R5377:Trpm7 UTSW 2 126842855 critical splice donor site probably null
R5574:Trpm7 UTSW 2 126813030 missense probably benign
R5782:Trpm7 UTSW 2 126797714 missense probably benign 0.04
R6044:Trpm7 UTSW 2 126814745 missense probably damaging 1.00
R6178:Trpm7 UTSW 2 126837381 missense probably damaging 1.00
R6196:Trpm7 UTSW 2 126825639 missense possibly damaging 0.66
R6457:Trpm7 UTSW 2 126807294 missense probably benign
R6530:Trpm7 UTSW 2 126812711 missense probably damaging 1.00
R6764:Trpm7 UTSW 2 126844420 missense possibly damaging 0.79
R6841:Trpm7 UTSW 2 126813021 missense probably benign 0.00
R6868:Trpm7 UTSW 2 126837414 missense probably damaging 1.00
R7250:Trpm7 UTSW 2 126826765 missense possibly damaging 0.87
R7402:Trpm7 UTSW 2 126799206 missense probably damaging 1.00
R7451:Trpm7 UTSW 2 126826737 missense probably damaging 0.99
R7486:Trpm7 UTSW 2 126831195 critical splice donor site probably null
R7509:Trpm7 UTSW 2 126849922 missense probably damaging 1.00
R7586:Trpm7 UTSW 2 126810165 missense probably benign
R7774:Trpm7 UTSW 2 126813238 missense probably benign 0.09
R7793:Trpm7 UTSW 2 126824075 nonsense probably null
R7812:Trpm7 UTSW 2 126799316 missense probably damaging 1.00
R7900:Trpm7 UTSW 2 126797498 missense probably benign 0.01
R7983:Trpm7 UTSW 2 126797498 missense probably benign 0.01
R8034:Trpm7 UTSW 2 126846199 missense probably damaging 0.98
X0026:Trpm7 UTSW 2 126829290 missense probably benign
Z1088:Trpm7 UTSW 2 126797281 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAATAGAAATTTGTGGGGCC -3'
(R):5'- TCCTGTGAAGTTATAATCAGCTCC -3'

Sequencing Primer
(F):5'- ATTTGTGGGGCCAGGTAAAGC -3'
(R):5'- AAGCTGGGAAAATCAGCC -3'
Posted On2016-12-20