Mutagenetix > Incidental Mutations

Incidental Mutation 'R5840:Sptlc3'

450360

Institutional Source

Beutler Lab

Gene Symbol

Sptlc3

Ensembl Gene

ENSMUSG00000039092

Gene Name

serine palmitoyltransferase, long chain base subunit 3

Synonyms

MMRRC Submission

044060-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.136) question?

Stock #

R5840 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

139493913-139637674 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 139547206 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 169 (N169Y)

Ref Sequence

ENSEMBL: ENSMUSP00000105710 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047370] [ENSMUST00000110083]

Predicted Effect

probably damaging
Transcript: ENSMUST00000047370
AA Change: N169Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000048313
Gene: ENSMUSG00000039092
AA Change: N169Y

Domain	Start	End	E-Value	Type
transmembrane domain	60	79	N/A	INTRINSIC
Pfam:Aminotran_1_2	160	520	4.8e-59	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000110083
AA Change: N169Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105710
Gene: ENSMUSG00000039092
AA Change: N169Y

Domain	Start	End	E-Value	Type
transmembrane domain	60	79	N/A	INTRINSIC
Pfam:Aminotran_1_2	160	520	4.8e-59	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134801

Meta Mutation Damage Score

0.9551

Coding Region Coverage

1x: 99.8%
3x: 99.3%
10x: 96.5%
20x: 88.1%

Validation Efficiency

99% (75/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The SPTLC3 gene encodes an isoform of the third subunit of serine palmitoyltransferase (SPT; EC 2.3.1.50), which catalyzes the rate-limiting step of the de novo synthesis of sphingolipids (Hornemann et al., 2006 [PubMed 17023427]). SPT contains 2 main subunits: the common SPTLC1 subunit (MIM 605712) and either SPTLC2 (MIM 605713) or its isoform SPTLC2L (SPTLC3), depending on the tissue in which biosynthesis occurs (Hornemann et al., 2006 [PubMed 17023427]). There are also 2 highly related isoforms of a third subunit, SSSPTA (MIM 613540) and SSSPTB (MIM 610412), that confer acyl-CoA preference of the SPT enzyme and are essential for maximal enzyme activity (Han et al., 2009 [PubMed 19416851]).[supplied by OMIM, Nov 2010]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca2	G	A	2: 25,433,359	R113Q	probably benign	Het
Aip	G	A	19: 4,116,010	P147L	possibly damaging	Het
Anapc1	A	C	2: 128,607,037		probably benign	Het
Arhgap42	C	T	9: 9,046,517	V240I	possibly damaging	Het
Axdnd1	T	C	1: 156,348,958	E684G	probably damaging	Het
BC005624	G	A	2: 30,981,857	R2W	probably benign	Het
Cd177	T	G	7: 24,758,070	Q182P	probably damaging	Het
Cdca5	G	A	19: 6,090,369	E187K	possibly damaging	Het
Chmp1a	T	C	8: 123,208,100	Q39R	probably benign	Het
Dab2ip	A	G	2: 35,727,499	I1079V	probably damaging	Het
Dip2c	A	T	13: 9,506,676	E85D	possibly damaging	Het
Elmo2	A	T	2: 165,295,552	S497R	possibly damaging	Het
Ephb6	C	T	6: 41,615,573	A339V	possibly damaging	Het
Foxred1	T	C	9: 35,210,139	K38E	probably damaging	Het
Frem2	T	A	3: 53,647,921	T1732S	probably damaging	Het
Fto	A	G	8: 91,666,440		probably benign	Het
Gm17430	T	A	18: 9,726,528	Q48L	probably damaging	Het
Gng2	A	G	14: 19,875,814	I70T	probably damaging	Het
Gtf2a2	A	G	9: 70,015,293		probably benign	Het
Invs	A	G	4: 48,396,284	D263G	probably damaging	Het
Itga2b	C	T	11: 102,461,331	V475M	probably damaging	Het
Kansl1l	A	G	1: 66,770,215		probably benign	Het
Klhl25	T	C	7: 75,866,692	F449L	possibly damaging	Het
Lamb1	T	A	12: 31,266,756	C83S	probably damaging	Het
Loxl4	G	T	19: 42,598,715	T648K	probably damaging	Het
Lrit2	T	C	14: 37,069,005	F214L	possibly damaging	Het
N4bp2	T	G	5: 65,808,094	L1162R	probably damaging	Het
Naa40	A	T	19: 7,230,008	I117N	probably benign	Het
Ncapd3	T	C	9: 27,094,758	S1492P	probably benign	Het
Nf2	T	A	11: 4,816,146	D128V	probably benign	Het
Nox4	T	C	7: 87,360,793	S401P	probably benign	Het
Nt5c1b	T	C	12: 10,377,171	V323A	probably damaging	Het
Olfr1474	G	A	19: 13,471,878	V303I	probably benign	Het
Olfr601	T	A	7: 103,358,369	H275L	probably damaging	Het
Olfr622	C	T	7: 103,639,256	V295I	probably benign	Het
Pcdhb14	T	C	18: 37,448,750	V303A	probably benign	Het
Pde8a	C	A	7: 81,213,965	H17Q	probably benign	Het
Pfkl	C	T	10: 77,988,724	V716I	probably benign	Het
Phc3	G	A	3: 30,936,583	S495L	possibly damaging	Het
Psg18	A	G	7: 18,346,602		probably benign	Het
Rcc2	T	G	4: 140,712,138	N175K	possibly damaging	Het
Rhot2	G	A	17: 25,840,058	T276I	probably benign	Het
Rnase9	A	T	14: 51,038,988	Y178N	probably benign	Het
Sema4b	T	C	7: 80,218,949	C297R	probably damaging	Het
Slc35d2	T	C	13: 64,118,413		probably null	Het
Srsf9	T	G	5: 115,331,465	M29R	probably benign	Het
Stip1	C	A	19: 7,022,068	D449Y	possibly damaging	Het
Syne2	T	A	12: 75,880,291		probably null	Het
Tgm5	A	G	2: 121,085,660		probably null	Het
Thbs2	A	T	17: 14,681,430		probably null	Het
Trak2	T	C	1: 58,919,273	E283G	probably damaging	Het
Trbv21	A	G	6: 41,202,858	Y36C	probably damaging	Het
Trpm7	A	T	2: 126,822,611	Y949*	probably null	Het
Ubqln5	T	C	7: 104,128,954	D221G	possibly damaging	Het
Ubxn4	T	A	1: 128,259,525	V85D	possibly damaging	Het
Vmn1r172	T	A	7: 23,660,175	W162R	probably benign	Het
Vrk2	A	G	11: 26,534,314		probably benign	Het
Zc3h8	A	C	2: 128,929,904	D276E	probably benign	Het
Zfp369	C	T	13: 65,297,278	T745I	possibly damaging	Het
Zfp608	T	C	18: 54,898,906	K654R	probably damaging	Het

Other mutations in Sptlc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01392:Sptlc3	APN	2	139546421	missense	possibly damaging	0.55
IGL01537:Sptlc3	APN	2	139589695	missense	possibly damaging	0.95
IGL01996:Sptlc3	APN	2	139581504	splice site	probably benign
IGL02512:Sptlc3	APN	2	139547203	missense	probably damaging	1.00
IGL03278:Sptlc3	APN	2	139589659	missense	probably damaging	1.00
IGL03286:Sptlc3	APN	2	139589659	missense	probably damaging	1.00
R0266:Sptlc3	UTSW	2	139596037	missense	possibly damaging	0.93
R0362:Sptlc3	UTSW	2	139546555	splice site	probably benign
R1464:Sptlc3	UTSW	2	139547234	missense	probably benign	0.00
R1464:Sptlc3	UTSW	2	139547234	missense	probably benign	0.00
R1494:Sptlc3	UTSW	2	139589560	missense	possibly damaging	0.58
R1847:Sptlc3	UTSW	2	139625923	missense	probably benign	0.08
R1919:Sptlc3	UTSW	2	139566675	missense	possibly damaging	0.66
R2093:Sptlc3	UTSW	2	139625874	missense	possibly damaging	0.89
R2396:Sptlc3	UTSW	2	139566586	missense	probably benign	0.44
R2972:Sptlc3	UTSW	2	139589661	missense	probably damaging	1.00
R2973:Sptlc3	UTSW	2	139589661	missense	probably damaging	1.00
R2974:Sptlc3	UTSW	2	139589661	missense	probably damaging	1.00
R4601:Sptlc3	UTSW	2	139636680	missense	probably benign	0.01
R4602:Sptlc3	UTSW	2	139636680	missense	probably benign	0.01
R4610:Sptlc3	UTSW	2	139636680	missense	probably benign	0.01
R4745:Sptlc3	UTSW	2	139547167	missense	probably damaging	1.00
R4779:Sptlc3	UTSW	2	139589589	missense	probably benign	0.04
R4992:Sptlc3	UTSW	2	139596003	missense	probably benign	0.04
R5162:Sptlc3	UTSW	2	139631343	missense	probably benign	0.11
R5401:Sptlc3	UTSW	2	139636723	missense	possibly damaging	0.75
R5406:Sptlc3	UTSW	2	139546478	missense	probably benign	0.26
R5642:Sptlc3	UTSW	2	139546408	missense	probably damaging	0.96
R6057:Sptlc3	UTSW	2	139581613	missense	probably damaging	0.99
R6376:Sptlc3	UTSW	2	139636772	missense	probably benign	0.21
R6852:Sptlc3	UTSW	2	139566586	missense	probably benign	0.44
R7026:Sptlc3	UTSW	2	139537688	missense	probably benign
R7412:Sptlc3	UTSW	2	139589617	missense	possibly damaging	0.75
R7516:Sptlc3	UTSW	2	139589518	missense	probably benign	0.11
R7733:Sptlc3	UTSW	2	139631368	missense	possibly damaging	0.77
R7826:Sptlc3	UTSW	2	139547195	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- GCCTGGAACTCTCACTAATGC -3'
(R):5'- CAGCCTTGACACTGTCAGAATTTG -3'

Sequencing Primer
(F):5'- TGGAACTCTCACTAATGCTATGTC -3'
(R):5'- CATTTCATTTCTGGTGCTGG -3'

Posted On

2016-12-20