Incidental Mutation 'R5840:Sptlc3'
ID450360
Institutional Source Beutler Lab
Gene Symbol Sptlc3
Ensembl Gene ENSMUSG00000039092
Gene Nameserine palmitoyltransferase, long chain base subunit 3
Synonyms
MMRRC Submission 044060-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R5840 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location139493913-139637674 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 139547206 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 169 (N169Y)
Ref Sequence ENSEMBL: ENSMUSP00000105710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047370] [ENSMUST00000110083]
Predicted Effect probably damaging
Transcript: ENSMUST00000047370
AA Change: N169Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048313
Gene: ENSMUSG00000039092
AA Change: N169Y

DomainStartEndE-ValueType
transmembrane domain 60 79 N/A INTRINSIC
Pfam:Aminotran_1_2 160 520 4.8e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110083
AA Change: N169Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105710
Gene: ENSMUSG00000039092
AA Change: N169Y

DomainStartEndE-ValueType
transmembrane domain 60 79 N/A INTRINSIC
Pfam:Aminotran_1_2 160 520 4.8e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134801
Meta Mutation Damage Score 0.9551 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 96.5%
  • 20x: 88.1%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The SPTLC3 gene encodes an isoform of the third subunit of serine palmitoyltransferase (SPT; EC 2.3.1.50), which catalyzes the rate-limiting step of the de novo synthesis of sphingolipids (Hornemann et al., 2006 [PubMed 17023427]). SPT contains 2 main subunits: the common SPTLC1 subunit (MIM 605712) and either SPTLC2 (MIM 605713) or its isoform SPTLC2L (SPTLC3), depending on the tissue in which biosynthesis occurs (Hornemann et al., 2006 [PubMed 17023427]). There are also 2 highly related isoforms of a third subunit, SSSPTA (MIM 613540) and SSSPTB (MIM 610412), that confer acyl-CoA preference of the SPT enzyme and are essential for maximal enzyme activity (Han et al., 2009 [PubMed 19416851]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G A 2: 25,433,359 R113Q probably benign Het
Aip G A 19: 4,116,010 P147L possibly damaging Het
Anapc1 A C 2: 128,607,037 probably benign Het
Arhgap42 C T 9: 9,046,517 V240I possibly damaging Het
Axdnd1 T C 1: 156,348,958 E684G probably damaging Het
BC005624 G A 2: 30,981,857 R2W probably benign Het
Cd177 T G 7: 24,758,070 Q182P probably damaging Het
Cdca5 G A 19: 6,090,369 E187K possibly damaging Het
Chmp1a T C 8: 123,208,100 Q39R probably benign Het
Dab2ip A G 2: 35,727,499 I1079V probably damaging Het
Dip2c A T 13: 9,506,676 E85D possibly damaging Het
Elmo2 A T 2: 165,295,552 S497R possibly damaging Het
Ephb6 C T 6: 41,615,573 A339V possibly damaging Het
Foxred1 T C 9: 35,210,139 K38E probably damaging Het
Frem2 T A 3: 53,647,921 T1732S probably damaging Het
Fto A G 8: 91,666,440 probably benign Het
Gm17430 T A 18: 9,726,528 Q48L probably damaging Het
Gng2 A G 14: 19,875,814 I70T probably damaging Het
Gtf2a2 A G 9: 70,015,293 probably benign Het
Invs A G 4: 48,396,284 D263G probably damaging Het
Itga2b C T 11: 102,461,331 V475M probably damaging Het
Kansl1l A G 1: 66,770,215 probably benign Het
Klhl25 T C 7: 75,866,692 F449L possibly damaging Het
Lamb1 T A 12: 31,266,756 C83S probably damaging Het
Loxl4 G T 19: 42,598,715 T648K probably damaging Het
Lrit2 T C 14: 37,069,005 F214L possibly damaging Het
N4bp2 T G 5: 65,808,094 L1162R probably damaging Het
Naa40 A T 19: 7,230,008 I117N probably benign Het
Ncapd3 T C 9: 27,094,758 S1492P probably benign Het
Nf2 T A 11: 4,816,146 D128V probably benign Het
Nox4 T C 7: 87,360,793 S401P probably benign Het
Nt5c1b T C 12: 10,377,171 V323A probably damaging Het
Olfr1474 G A 19: 13,471,878 V303I probably benign Het
Olfr601 T A 7: 103,358,369 H275L probably damaging Het
Olfr622 C T 7: 103,639,256 V295I probably benign Het
Pcdhb14 T C 18: 37,448,750 V303A probably benign Het
Pde8a C A 7: 81,213,965 H17Q probably benign Het
Pfkl C T 10: 77,988,724 V716I probably benign Het
Phc3 G A 3: 30,936,583 S495L possibly damaging Het
Psg18 A G 7: 18,346,602 probably benign Het
Rcc2 T G 4: 140,712,138 N175K possibly damaging Het
Rhot2 G A 17: 25,840,058 T276I probably benign Het
Rnase9 A T 14: 51,038,988 Y178N probably benign Het
Sema4b T C 7: 80,218,949 C297R probably damaging Het
Slc35d2 T C 13: 64,118,413 probably null Het
Srsf9 T G 5: 115,331,465 M29R probably benign Het
Stip1 C A 19: 7,022,068 D449Y possibly damaging Het
Syne2 T A 12: 75,880,291 probably null Het
Tgm5 A G 2: 121,085,660 probably null Het
Thbs2 A T 17: 14,681,430 probably null Het
Trak2 T C 1: 58,919,273 E283G probably damaging Het
Trbv21 A G 6: 41,202,858 Y36C probably damaging Het
Trpm7 A T 2: 126,822,611 Y949* probably null Het
Ubqln5 T C 7: 104,128,954 D221G possibly damaging Het
Ubxn4 T A 1: 128,259,525 V85D possibly damaging Het
Vmn1r172 T A 7: 23,660,175 W162R probably benign Het
Vrk2 A G 11: 26,534,314 probably benign Het
Zc3h8 A C 2: 128,929,904 D276E probably benign Het
Zfp369 C T 13: 65,297,278 T745I possibly damaging Het
Zfp608 T C 18: 54,898,906 K654R probably damaging Het
Other mutations in Sptlc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Sptlc3 APN 2 139546421 missense possibly damaging 0.55
IGL01537:Sptlc3 APN 2 139589695 missense possibly damaging 0.95
IGL01996:Sptlc3 APN 2 139581504 splice site probably benign
IGL02512:Sptlc3 APN 2 139547203 missense probably damaging 1.00
IGL03278:Sptlc3 APN 2 139589659 missense probably damaging 1.00
IGL03286:Sptlc3 APN 2 139589659 missense probably damaging 1.00
R0266:Sptlc3 UTSW 2 139596037 missense possibly damaging 0.93
R0362:Sptlc3 UTSW 2 139546555 splice site probably benign
R1464:Sptlc3 UTSW 2 139547234 missense probably benign 0.00
R1464:Sptlc3 UTSW 2 139547234 missense probably benign 0.00
R1494:Sptlc3 UTSW 2 139589560 missense possibly damaging 0.58
R1847:Sptlc3 UTSW 2 139625923 missense probably benign 0.08
R1919:Sptlc3 UTSW 2 139566675 missense possibly damaging 0.66
R2093:Sptlc3 UTSW 2 139625874 missense possibly damaging 0.89
R2396:Sptlc3 UTSW 2 139566586 missense probably benign 0.44
R2972:Sptlc3 UTSW 2 139589661 missense probably damaging 1.00
R2973:Sptlc3 UTSW 2 139589661 missense probably damaging 1.00
R2974:Sptlc3 UTSW 2 139589661 missense probably damaging 1.00
R4601:Sptlc3 UTSW 2 139636680 missense probably benign 0.01
R4602:Sptlc3 UTSW 2 139636680 missense probably benign 0.01
R4610:Sptlc3 UTSW 2 139636680 missense probably benign 0.01
R4745:Sptlc3 UTSW 2 139547167 missense probably damaging 1.00
R4779:Sptlc3 UTSW 2 139589589 missense probably benign 0.04
R4992:Sptlc3 UTSW 2 139596003 missense probably benign 0.04
R5162:Sptlc3 UTSW 2 139631343 missense probably benign 0.11
R5401:Sptlc3 UTSW 2 139636723 missense possibly damaging 0.75
R5406:Sptlc3 UTSW 2 139546478 missense probably benign 0.26
R5642:Sptlc3 UTSW 2 139546408 missense probably damaging 0.96
R6057:Sptlc3 UTSW 2 139581613 missense probably damaging 0.99
R6376:Sptlc3 UTSW 2 139636772 missense probably benign 0.21
R6852:Sptlc3 UTSW 2 139566586 missense probably benign 0.44
R7026:Sptlc3 UTSW 2 139537688 missense probably benign
R7412:Sptlc3 UTSW 2 139589617 missense possibly damaging 0.75
R7516:Sptlc3 UTSW 2 139589518 missense probably benign 0.11
R7733:Sptlc3 UTSW 2 139631368 missense possibly damaging 0.77
R7826:Sptlc3 UTSW 2 139547195 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GCCTGGAACTCTCACTAATGC -3'
(R):5'- CAGCCTTGACACTGTCAGAATTTG -3'

Sequencing Primer
(F):5'- TGGAACTCTCACTAATGCTATGTC -3'
(R):5'- CATTTCATTTCTGGTGCTGG -3'
Posted On2016-12-20