Mutagenetix > Incidental Mutation

Incidental Mutation 'R5840:Invs'

450365

Institutional Source

Beutler Lab

Gene Symbol

Invs

Ensembl Gene

ENSMUSG00000028344

Gene Name

inversin

Synonyms

MMRRC Submission

044060-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.751) question?

Stock #

R5840 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

48279760-48431954 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 48396284 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 263 (D263G)

Ref Sequence

ENSEMBL: ENSMUSP00000138580 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030029] [ENSMUST00000143433]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000030029
AA Change: D319G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000030029
Gene: ENSMUSG00000028344
AA Change: D319G

Domain	Start	End	E-Value	Type
ANK	47	76	2.66e-5	SMART
ANK	80	110	1.8e-2	SMART
ANK	113	144	1.63e0	SMART
ANK	148	177	6.46e-4	SMART
ANK	181	215	3.44e1	SMART
ANK	220	250	1.11e-2	SMART
ANK	254	285	2.07e-2	SMART
ANK	288	317	3.18e-3	SMART
ANK	321	350	3.91e-3	SMART
ANK	356	385	2.28e-4	SMART
ANK	389	418	8.39e-3	SMART
ANK	422	451	3.76e-5	SMART
ANK	455	484	2.45e-4	SMART
ANK	488	517	1.31e-4	SMART
ANK	523	553	6.71e-2	SMART
IQ	554	576	5.75e-2	SMART
low complexity region	589	607	N/A	INTRINSIC
IQ	913	935	2.46e-1	SMART
low complexity region	973	989	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129480

Predicted Effect

probably damaging
Transcript: ENSMUST00000143433
AA Change: D263G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138580
Gene: ENSMUSG00000028344
AA Change: D263G

Domain	Start	End	E-Value	Type
ANK	47	76	2.66e-5	SMART
ANK	80	110	1.8e-2	SMART
ANK	113	144	1.63e0	SMART
ANK	164	194	1.11e-2	SMART
ANK	198	229	2.07e-2	SMART
ANK	232	261	3.18e-3	SMART
ANK	265	294	3.91e-3	SMART
ANK	300	329	2.28e-4	SMART
ANK	333	362	8.39e-3	SMART
ANK	366	395	3.76e-5	SMART
ANK	399	428	2.45e-4	SMART

Meta Mutation Damage Score

0.6573

Coding Region Coverage

1x: 99.8%
3x: 99.3%
10x: 96.5%
20x: 88.1%

Validation Efficiency

99% (75/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin domains and two IQ calmodulin-binding domains. The encoded protein may function in renal tubular development and function, and in left-right axis determination. This protein interacts with nephrocystin and infers a connection between primary cilia function and left-right axis determination. A similar protein in mice interacts with calmodulin. Mutations in this gene have been associated with nephronophthisis type 2. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Transgenic mice homozygous for an insertional mutation exhibit complete inversion of the L-R body axis, reversal of embryo turning, complex cardiac anomalies, an abnormally slow turbulent leftward nodal flow, and renal cyst formation. Most succumb to renal failure within 1 week of life. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca2	G	A	2: 25,433,359	R113Q	probably benign	Het
Aip	G	A	19: 4,116,010	P147L	possibly damaging	Het
Anapc1	A	C	2: 128,607,037		probably benign	Het
Arhgap42	C	T	9: 9,046,517	V240I	possibly damaging	Het
Axdnd1	T	C	1: 156,348,958	E684G	probably damaging	Het
BC005624	G	A	2: 30,981,857	R2W	probably benign	Het
Cd177	T	G	7: 24,758,070	Q182P	probably damaging	Het
Cdca5	G	A	19: 6,090,369	E187K	possibly damaging	Het
Chmp1a	T	C	8: 123,208,100	Q39R	probably benign	Het
Dab2ip	A	G	2: 35,727,499	I1079V	probably damaging	Het
Dip2c	A	T	13: 9,506,676	E85D	possibly damaging	Het
Elmo2	A	T	2: 165,295,552	S497R	possibly damaging	Het
Ephb6	C	T	6: 41,615,573	A339V	possibly damaging	Het
Foxred1	T	C	9: 35,210,139	K38E	probably damaging	Het
Frem2	T	A	3: 53,647,921	T1732S	probably damaging	Het
Fto	A	G	8: 91,666,440		probably benign	Het
Gm17430	T	A	18: 9,726,528	Q48L	probably damaging	Het
Gng2	A	G	14: 19,875,814	I70T	probably damaging	Het
Gtf2a2	A	G	9: 70,015,293		probably benign	Het
Itga2b	C	T	11: 102,461,331	V475M	probably damaging	Het
Kansl1l	A	G	1: 66,770,215		probably benign	Het
Klhl25	T	C	7: 75,866,692	F449L	possibly damaging	Het
Lamb1	T	A	12: 31,266,756	C83S	probably damaging	Het
Loxl4	G	T	19: 42,598,715	T648K	probably damaging	Het
Lrit2	T	C	14: 37,069,005	F214L	possibly damaging	Het
N4bp2	T	G	5: 65,808,094	L1162R	probably damaging	Het
Naa40	A	T	19: 7,230,008	I117N	probably benign	Het
Ncapd3	T	C	9: 27,094,758	S1492P	probably benign	Het
Nf2	T	A	11: 4,816,146	D128V	probably benign	Het
Nox4	T	C	7: 87,360,793	S401P	probably benign	Het
Nt5c1b	T	C	12: 10,377,171	V323A	probably damaging	Het
Olfr1474	G	A	19: 13,471,878	V303I	probably benign	Het
Olfr601	T	A	7: 103,358,369	H275L	probably damaging	Het
Olfr622	C	T	7: 103,639,256	V295I	probably benign	Het
Pcdhb14	T	C	18: 37,448,750	V303A	probably benign	Het
Pde8a	C	A	7: 81,213,965	H17Q	probably benign	Het
Pfkl	C	T	10: 77,988,724	V716I	probably benign	Het
Phc3	G	A	3: 30,936,583	S495L	possibly damaging	Het
Psg18	A	G	7: 18,346,602		probably benign	Het
Rcc2	T	G	4: 140,712,138	N175K	possibly damaging	Het
Rhot2	G	A	17: 25,840,058	T276I	probably benign	Het
Rnase9	A	T	14: 51,038,988	Y178N	probably benign	Het
Sema4b	T	C	7: 80,218,949	C297R	probably damaging	Het
Slc35d2	T	C	13: 64,118,413		probably null	Het
Sptlc3	A	T	2: 139,547,206	N169Y	probably damaging	Het
Srsf9	T	G	5: 115,331,465	M29R	probably benign	Het
Stip1	C	A	19: 7,022,068	D449Y	possibly damaging	Het
Syne2	T	A	12: 75,880,291		probably null	Het
Tgm5	A	G	2: 121,085,660		probably null	Het
Thbs2	A	T	17: 14,681,430		probably null	Het
Trak2	T	C	1: 58,919,273	E283G	probably damaging	Het
Trbv21	A	G	6: 41,202,858	Y36C	probably damaging	Het
Trpm7	A	T	2: 126,822,611	Y949*	probably null	Het
Ubqln5	T	C	7: 104,128,954	D221G	possibly damaging	Het
Ubxn4	T	A	1: 128,259,525	V85D	possibly damaging	Het
Vmn1r172	T	A	7: 23,660,175	W162R	probably benign	Het
Vrk2	A	G	11: 26,534,314		probably benign	Het
Zc3h8	A	C	2: 128,929,904	D276E	probably benign	Het
Zfp369	C	T	13: 65,297,278	T745I	possibly damaging	Het
Zfp608	T	C	18: 54,898,906	K654R	probably damaging	Het

Other mutations in Invs

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Invs	APN	4	48402909	missense	probably damaging	0.98
IGL00487:Invs	APN	4	48407689	nonsense	probably null
IGL01487:Invs	APN	4	48398136	missense	probably benign	0.26
IGL01696:Invs	APN	4	48425997	missense	probably damaging	1.00
IGL02238:Invs	APN	4	48390029	missense	probably damaging	1.00
IGL03286:Invs	APN	4	48382261	missense	probably benign	0.26
R0645:Invs	UTSW	4	48407653	missense	probably benign	0.00
R0661:Invs	UTSW	4	48421861	missense	probably benign
R0698:Invs	UTSW	4	48396364	missense	probably benign	0.04
R0763:Invs	UTSW	4	48392628	missense	possibly damaging	0.82
R1183:Invs	UTSW	4	48421725	missense	possibly damaging	0.68
R1381:Invs	UTSW	4	48421942	nonsense	probably null
R1511:Invs	UTSW	4	48382148	missense	possibly damaging	0.82
R1843:Invs	UTSW	4	48422035	missense	probably damaging	0.96
R1903:Invs	UTSW	4	48402824	splice site	probably null
R1928:Invs	UTSW	4	48390095	missense	probably damaging	1.00
R1990:Invs	UTSW	4	48392599	missense	possibly damaging	0.88
R2063:Invs	UTSW	4	48396287	missense	probably damaging	1.00
R2064:Invs	UTSW	4	48396287	missense	probably damaging	1.00
R2065:Invs	UTSW	4	48396287	missense	probably damaging	1.00
R2066:Invs	UTSW	4	48396287	missense	probably damaging	1.00
R4744:Invs	UTSW	4	48397609	missense	probably damaging	1.00
R4997:Invs	UTSW	4	48396332	missense	probably damaging	0.98
R5011:Invs	UTSW	4	48421807	missense	probably damaging	1.00
R5013:Invs	UTSW	4	48421807	missense	probably damaging	1.00
R5083:Invs	UTSW	4	48396307	missense	possibly damaging	0.90
R5184:Invs	UTSW	4	48283242	utr 5 prime	probably benign
R5258:Invs	UTSW	4	48396374	missense	possibly damaging	0.82
R5375:Invs	UTSW	4	48385262	missense	probably benign	0.12
R5509:Invs	UTSW	4	48396337	missense	probably damaging	1.00
R5560:Invs	UTSW	4	48416084	missense	probably benign	0.00
R5748:Invs	UTSW	4	48307823	missense	probably damaging	0.98
R5813:Invs	UTSW	4	48398146	missense	probably damaging	0.98
R5984:Invs	UTSW	4	48421674	missense	probably benign	0.00
R6513:Invs	UTSW	4	48397534	missense	possibly damaging	0.46
R6637:Invs	UTSW	4	48416203	splice site	probably null
R6667:Invs	UTSW	4	48402870	missense	possibly damaging	0.66
R6838:Invs	UTSW	4	48283278	missense	possibly damaging	0.95
R6921:Invs	UTSW	4	48396260	missense	possibly damaging	0.46
R6945:Invs	UTSW	4	48421785	missense	probably benign	0.00
R7102:Invs	UTSW	4	48407674	missense	probably benign	0.21
R7142:Invs	UTSW	4	48407696	missense	probably damaging	1.00
R7263:Invs	UTSW	4	48396381	missense	probably damaging	1.00
R7283:Invs	UTSW	4	48392526	splice site	probably null
R7461:Invs	UTSW	4	48392668	missense	probably damaging	1.00
R7503:Invs	UTSW	4	48396347	missense	probably damaging	0.96
R7581:Invs	UTSW	4	48421909	missense	probably benign	0.00
R7613:Invs	UTSW	4	48392668	missense	probably damaging	1.00
R7861:Invs	UTSW	4	48397559	missense	possibly damaging	0.50
R8316:Invs	UTSW	4	48426199	missense	possibly damaging	0.68
R8321:Invs	UTSW	4	48283267	missense	probably benign	0.13
R8500:Invs	UTSW	4	48422109	missense	probably damaging	1.00
R8544:Invs	UTSW	4	48397598	missense	probably damaging	0.96
R9171:Invs	UTSW	4	48398149	missense	possibly damaging	0.90
R9663:Invs	UTSW	4	48426218	missense	probably damaging	1.00
X0026:Invs	UTSW	4	48398221	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- CCAAATGTAATGGTGTTGCATGAG -3'
(R):5'- ACTTGGTGGCACCTTTCAG -3'

Sequencing Primer
(F):5'- TGTTCTTGAAGTGTTCCAGAAAC -3'
(R):5'- GTGGCACCTTTCAGCACCC -3'

Posted On

2016-12-20