Mutagenetix > Incidental Mutations

Incidental Mutation 'R5840:Ephb6'

450370

Institutional Source

Beutler Lab

Gene Symbol

Ephb6

Ensembl Gene

ENSMUSG00000029869

Gene Name

Eph receptor B6

Synonyms

Cekl, Mep

MMRRC Submission

044060-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.700) question?

Stock #

R5840 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

41605482-41620509 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 41615573 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 339 (A339V)

Ref Sequence

ENSEMBL: ENSMUSP00000110380 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114732]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114732
AA Change: A339V

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000110380
Gene: ENSMUSG00000029869
AA Change: A339V

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
EPH_lbd	34	227	2.18e-100	SMART
low complexity region	242	255	N/A	INTRINSIC
Pfam:GCC2_GCC3	299	341	1.9e-9	PFAM
FN3	365	462	3.59e-3	SMART
FN3	481	562	3.73e-10	SMART
Pfam:EphA2_TM	589	660	3.4e-16	PFAM
Pfam:Pkinase	663	908	1.4e-29	PFAM
Pfam:Pkinase_Tyr	663	908	1.1e-67	PFAM
SAM	938	1005	1e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167082

Predicted Effect

probably benign
Transcript: ENSMUST00000167497

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170624

Meta Mutation Damage Score

0.0993

Coding Region Coverage

1x: 99.8%
3x: 99.3%
10x: 96.5%
20x: 88.1%

Validation Efficiency

99% (75/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of transmembrane proteins that function as receptors for ephrin-B family proteins. Unlike other members of this family, the encoded protein does not contain a functional kinase domain. Activity of this protein can influence cell adhesion and migration. Expression of this gene is downregulated during tumor progression, suggesting that the protein may suppress tumor invasion and metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: T cell responses such as lymphokine secretion, proliferation, and the development of delayed-type skin hypersensitivity and experimental autoimmune encephalitis were compromised in homozygous null mutants. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca2	G	A	2: 25,433,359	R113Q	probably benign	Het
Aip	G	A	19: 4,116,010	P147L	possibly damaging	Het
Anapc1	A	C	2: 128,607,037		probably benign	Het
Arhgap42	C	T	9: 9,046,517	V240I	possibly damaging	Het
Axdnd1	T	C	1: 156,348,958	E684G	probably damaging	Het
BC005624	G	A	2: 30,981,857	R2W	probably benign	Het
Cd177	T	G	7: 24,758,070	Q182P	probably damaging	Het
Cdca5	G	A	19: 6,090,369	E187K	possibly damaging	Het
Chmp1a	T	C	8: 123,208,100	Q39R	probably benign	Het
Dab2ip	A	G	2: 35,727,499	I1079V	probably damaging	Het
Dip2c	A	T	13: 9,506,676	E85D	possibly damaging	Het
Elmo2	A	T	2: 165,295,552	S497R	possibly damaging	Het
Foxred1	T	C	9: 35,210,139	K38E	probably damaging	Het
Frem2	T	A	3: 53,647,921	T1732S	probably damaging	Het
Fto	A	G	8: 91,666,440		probably benign	Het
Gm17430	T	A	18: 9,726,528	Q48L	probably damaging	Het
Gng2	A	G	14: 19,875,814	I70T	probably damaging	Het
Gtf2a2	A	G	9: 70,015,293		probably benign	Het
Invs	A	G	4: 48,396,284	D263G	probably damaging	Het
Itga2b	C	T	11: 102,461,331	V475M	probably damaging	Het
Kansl1l	A	G	1: 66,770,215		probably benign	Het
Klhl25	T	C	7: 75,866,692	F449L	possibly damaging	Het
Lamb1	T	A	12: 31,266,756	C83S	probably damaging	Het
Loxl4	G	T	19: 42,598,715	T648K	probably damaging	Het
Lrit2	T	C	14: 37,069,005	F214L	possibly damaging	Het
N4bp2	T	G	5: 65,808,094	L1162R	probably damaging	Het
Naa40	A	T	19: 7,230,008	I117N	probably benign	Het
Ncapd3	T	C	9: 27,094,758	S1492P	probably benign	Het
Nf2	T	A	11: 4,816,146	D128V	probably benign	Het
Nox4	T	C	7: 87,360,793	S401P	probably benign	Het
Nt5c1b	T	C	12: 10,377,171	V323A	probably damaging	Het
Olfr1474	G	A	19: 13,471,878	V303I	probably benign	Het
Olfr601	T	A	7: 103,358,369	H275L	probably damaging	Het
Olfr622	C	T	7: 103,639,256	V295I	probably benign	Het
Pcdhb14	T	C	18: 37,448,750	V303A	probably benign	Het
Pde8a	C	A	7: 81,213,965	H17Q	probably benign	Het
Pfkl	C	T	10: 77,988,724	V716I	probably benign	Het
Phc3	G	A	3: 30,936,583	S495L	possibly damaging	Het
Psg18	A	G	7: 18,346,602		probably benign	Het
Rcc2	T	G	4: 140,712,138	N175K	possibly damaging	Het
Rhot2	G	A	17: 25,840,058	T276I	probably benign	Het
Rnase9	A	T	14: 51,038,988	Y178N	probably benign	Het
Sema4b	T	C	7: 80,218,949	C297R	probably damaging	Het
Slc35d2	T	C	13: 64,118,413		probably null	Het
Sptlc3	A	T	2: 139,547,206	N169Y	probably damaging	Het
Srsf9	T	G	5: 115,331,465	M29R	probably benign	Het
Stip1	C	A	19: 7,022,068	D449Y	possibly damaging	Het
Syne2	T	A	12: 75,880,291		probably null	Het
Tgm5	A	G	2: 121,085,660		probably null	Het
Thbs2	A	T	17: 14,681,430		probably null	Het
Trak2	T	C	1: 58,919,273	E283G	probably damaging	Het
Trbv21	A	G	6: 41,202,858	Y36C	probably damaging	Het
Trpm7	A	T	2: 126,822,611	Y949*	probably null	Het
Ubqln5	T	C	7: 104,128,954	D221G	possibly damaging	Het
Ubxn4	T	A	1: 128,259,525	V85D	possibly damaging	Het
Vmn1r172	T	A	7: 23,660,175	W162R	probably benign	Het
Vrk2	A	G	11: 26,534,314		probably benign	Het
Zc3h8	A	C	2: 128,929,904	D276E	probably benign	Het
Zfp369	C	T	13: 65,297,278	T745I	possibly damaging	Het
Zfp608	T	C	18: 54,898,906	K654R	probably damaging	Het

Other mutations in Ephb6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01375:Ephb6	APN	6	41615911	unclassified	probably benign
IGL01691:Ephb6	APN	6	41614515	missense	probably benign	0.26
IGL02052:Ephb6	APN	6	41613322	missense	probably benign
IGL02079:Ephb6	APN	6	41616014	missense	possibly damaging	0.57
IGL03089:Ephb6	APN	6	41614174	missense	probably damaging	1.00
P4748:Ephb6	UTSW	6	41617285	missense	probably damaging	0.96
R0022:Ephb6	UTSW	6	41614569	missense	probably damaging	0.98
R0022:Ephb6	UTSW	6	41614569	missense	probably damaging	0.98
R0106:Ephb6	UTSW	6	41619594	unclassified	probably benign
R0106:Ephb6	UTSW	6	41619594	unclassified	probably benign
R0973:Ephb6	UTSW	6	41614104	missense	probably damaging	0.98
R0973:Ephb6	UTSW	6	41614104	missense	probably damaging	0.98
R0974:Ephb6	UTSW	6	41614104	missense	probably damaging	0.98
R1465:Ephb6	UTSW	6	41616106	missense	probably damaging	1.00
R1465:Ephb6	UTSW	6	41616106	missense	probably damaging	1.00
R1610:Ephb6	UTSW	6	41614373	nonsense	probably null
R1658:Ephb6	UTSW	6	41614245	missense	probably damaging	1.00
R1687:Ephb6	UTSW	6	41617366	missense	probably benign	0.08
R1733:Ephb6	UTSW	6	41619720	missense	probably benign	0.10
R2191:Ephb6	UTSW	6	41616085	missense	possibly damaging	0.82
R2439:Ephb6	UTSW	6	41618735	missense	probably benign	0.31
R2915:Ephb6	UTSW	6	41614238	missense	probably damaging	1.00
R3020:Ephb6	UTSW	6	41614521	missense	probably damaging	1.00
R3499:Ephb6	UTSW	6	41616159	nonsense	probably null
R4606:Ephb6	UTSW	6	41616574	missense	probably benign	0.15
R4663:Ephb6	UTSW	6	41617865	missense	probably damaging	1.00
R4668:Ephb6	UTSW	6	41614602	missense	possibly damaging	0.91
R4762:Ephb6	UTSW	6	41618160	missense	probably damaging	0.99
R4767:Ephb6	UTSW	6	41614185	missense	possibly damaging	0.81
R4780:Ephb6	UTSW	6	41616139	missense	probably damaging	1.00
R4846:Ephb6	UTSW	6	41616809	missense	probably benign
R4851:Ephb6	UTSW	6	41618145	missense	probably benign	0.00
R5016:Ephb6	UTSW	6	41618107	missense	probably benign	0.01
R5122:Ephb6	UTSW	6	41613404	missense	probably benign	0.00
R5313:Ephb6	UTSW	6	41616793	missense	possibly damaging	0.68
R5615:Ephb6	UTSW	6	41619291	missense	probably benign
R5623:Ephb6	UTSW	6	41616481	missense	probably benign	0.20
R5686:Ephb6	UTSW	6	41619704	missense	possibly damaging	0.57
R6147:Ephb6	UTSW	6	41616781	missense	probably damaging	1.00
R6645:Ephb6	UTSW	6	41617272	missense	probably benign	0.01
R6730:Ephb6	UTSW	6	41617374	nonsense	probably null
R7412:Ephb6	UTSW	6	41620239	missense	probably damaging	1.00
R7442:Ephb6	UTSW	6	41618047	splice site	probably null
R7759:Ephb6	UTSW	6	41614605	missense	probably benign	0.00
R7857:Ephb6	UTSW	6	41613397	missense	probably benign
R8425:Ephb6	UTSW	6	41618646	missense	probably damaging	0.98
X0027:Ephb6	UTSW	6	41620080	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- TATGCAGCCCAAAACAGGAG -3'
(R):5'- CTCAAGTGAACTCCAAAGACCTTTC -3'

Sequencing Primer
(F):5'- CCATCTCTGGGGAACAAAGGAC -3'
(R):5'- GTGAACTCCAAAGACCTTTCACTTC -3'

Posted On

2016-12-20