Incidental Mutation 'R5840:Ephb6'
ID450370
Institutional Source Beutler Lab
Gene Symbol Ephb6
Ensembl Gene ENSMUSG00000029869
Gene NameEph receptor B6
SynonymsCekl, Mep
MMRRC Submission 044060-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.700) question?
Stock #R5840 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location41605482-41620509 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 41615573 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 339 (A339V)
Ref Sequence ENSEMBL: ENSMUSP00000110380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114732]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114732
AA Change: A339V

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110380
Gene: ENSMUSG00000029869
AA Change: A339V

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
EPH_lbd 34 227 2.18e-100 SMART
low complexity region 242 255 N/A INTRINSIC
Pfam:GCC2_GCC3 299 341 1.9e-9 PFAM
FN3 365 462 3.59e-3 SMART
FN3 481 562 3.73e-10 SMART
Pfam:EphA2_TM 589 660 3.4e-16 PFAM
Pfam:Pkinase 663 908 1.4e-29 PFAM
Pfam:Pkinase_Tyr 663 908 1.1e-67 PFAM
SAM 938 1005 1e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167082
Predicted Effect probably benign
Transcript: ENSMUST00000167497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170624
Meta Mutation Damage Score 0.0993 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 96.5%
  • 20x: 88.1%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of transmembrane proteins that function as receptors for ephrin-B family proteins. Unlike other members of this family, the encoded protein does not contain a functional kinase domain. Activity of this protein can influence cell adhesion and migration. Expression of this gene is downregulated during tumor progression, suggesting that the protein may suppress tumor invasion and metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: T cell responses such as lymphokine secretion, proliferation, and the development of delayed-type skin hypersensitivity and experimental autoimmune encephalitis were compromised in homozygous null mutants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G A 2: 25,433,359 R113Q probably benign Het
Aip G A 19: 4,116,010 P147L possibly damaging Het
Anapc1 A C 2: 128,607,037 probably benign Het
Arhgap42 C T 9: 9,046,517 V240I possibly damaging Het
Axdnd1 T C 1: 156,348,958 E684G probably damaging Het
BC005624 G A 2: 30,981,857 R2W probably benign Het
Cd177 T G 7: 24,758,070 Q182P probably damaging Het
Cdca5 G A 19: 6,090,369 E187K possibly damaging Het
Chmp1a T C 8: 123,208,100 Q39R probably benign Het
Dab2ip A G 2: 35,727,499 I1079V probably damaging Het
Dip2c A T 13: 9,506,676 E85D possibly damaging Het
Elmo2 A T 2: 165,295,552 S497R possibly damaging Het
Foxred1 T C 9: 35,210,139 K38E probably damaging Het
Frem2 T A 3: 53,647,921 T1732S probably damaging Het
Fto A G 8: 91,666,440 probably benign Het
Gm17430 T A 18: 9,726,528 Q48L probably damaging Het
Gng2 A G 14: 19,875,814 I70T probably damaging Het
Gtf2a2 A G 9: 70,015,293 probably benign Het
Invs A G 4: 48,396,284 D263G probably damaging Het
Itga2b C T 11: 102,461,331 V475M probably damaging Het
Kansl1l A G 1: 66,770,215 probably benign Het
Klhl25 T C 7: 75,866,692 F449L possibly damaging Het
Lamb1 T A 12: 31,266,756 C83S probably damaging Het
Loxl4 G T 19: 42,598,715 T648K probably damaging Het
Lrit2 T C 14: 37,069,005 F214L possibly damaging Het
N4bp2 T G 5: 65,808,094 L1162R probably damaging Het
Naa40 A T 19: 7,230,008 I117N probably benign Het
Ncapd3 T C 9: 27,094,758 S1492P probably benign Het
Nf2 T A 11: 4,816,146 D128V probably benign Het
Nox4 T C 7: 87,360,793 S401P probably benign Het
Nt5c1b T C 12: 10,377,171 V323A probably damaging Het
Olfr1474 G A 19: 13,471,878 V303I probably benign Het
Olfr601 T A 7: 103,358,369 H275L probably damaging Het
Olfr622 C T 7: 103,639,256 V295I probably benign Het
Pcdhb14 T C 18: 37,448,750 V303A probably benign Het
Pde8a C A 7: 81,213,965 H17Q probably benign Het
Pfkl C T 10: 77,988,724 V716I probably benign Het
Phc3 G A 3: 30,936,583 S495L possibly damaging Het
Psg18 A G 7: 18,346,602 probably benign Het
Rcc2 T G 4: 140,712,138 N175K possibly damaging Het
Rhot2 G A 17: 25,840,058 T276I probably benign Het
Rnase9 A T 14: 51,038,988 Y178N probably benign Het
Sema4b T C 7: 80,218,949 C297R probably damaging Het
Slc35d2 T C 13: 64,118,413 probably null Het
Sptlc3 A T 2: 139,547,206 N169Y probably damaging Het
Srsf9 T G 5: 115,331,465 M29R probably benign Het
Stip1 C A 19: 7,022,068 D449Y possibly damaging Het
Syne2 T A 12: 75,880,291 probably null Het
Tgm5 A G 2: 121,085,660 probably null Het
Thbs2 A T 17: 14,681,430 probably null Het
Trak2 T C 1: 58,919,273 E283G probably damaging Het
Trbv21 A G 6: 41,202,858 Y36C probably damaging Het
Trpm7 A T 2: 126,822,611 Y949* probably null Het
Ubqln5 T C 7: 104,128,954 D221G possibly damaging Het
Ubxn4 T A 1: 128,259,525 V85D possibly damaging Het
Vmn1r172 T A 7: 23,660,175 W162R probably benign Het
Vrk2 A G 11: 26,534,314 probably benign Het
Zc3h8 A C 2: 128,929,904 D276E probably benign Het
Zfp369 C T 13: 65,297,278 T745I possibly damaging Het
Zfp608 T C 18: 54,898,906 K654R probably damaging Het
Other mutations in Ephb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Ephb6 APN 6 41615911 unclassified probably benign
IGL01691:Ephb6 APN 6 41614515 missense probably benign 0.26
IGL02052:Ephb6 APN 6 41613322 missense probably benign
IGL02079:Ephb6 APN 6 41616014 missense possibly damaging 0.57
IGL03089:Ephb6 APN 6 41614174 missense probably damaging 1.00
P4748:Ephb6 UTSW 6 41617285 missense probably damaging 0.96
R0022:Ephb6 UTSW 6 41614569 missense probably damaging 0.98
R0022:Ephb6 UTSW 6 41614569 missense probably damaging 0.98
R0106:Ephb6 UTSW 6 41619594 unclassified probably benign
R0106:Ephb6 UTSW 6 41619594 unclassified probably benign
R0973:Ephb6 UTSW 6 41614104 missense probably damaging 0.98
R0973:Ephb6 UTSW 6 41614104 missense probably damaging 0.98
R0974:Ephb6 UTSW 6 41614104 missense probably damaging 0.98
R1465:Ephb6 UTSW 6 41616106 missense probably damaging 1.00
R1465:Ephb6 UTSW 6 41616106 missense probably damaging 1.00
R1610:Ephb6 UTSW 6 41614373 nonsense probably null
R1658:Ephb6 UTSW 6 41614245 missense probably damaging 1.00
R1687:Ephb6 UTSW 6 41617366 missense probably benign 0.08
R1733:Ephb6 UTSW 6 41619720 missense probably benign 0.10
R2191:Ephb6 UTSW 6 41616085 missense possibly damaging 0.82
R2439:Ephb6 UTSW 6 41618735 missense probably benign 0.31
R2915:Ephb6 UTSW 6 41614238 missense probably damaging 1.00
R3020:Ephb6 UTSW 6 41614521 missense probably damaging 1.00
R3499:Ephb6 UTSW 6 41616159 nonsense probably null
R4606:Ephb6 UTSW 6 41616574 missense probably benign 0.15
R4663:Ephb6 UTSW 6 41617865 missense probably damaging 1.00
R4668:Ephb6 UTSW 6 41614602 missense possibly damaging 0.91
R4762:Ephb6 UTSW 6 41618160 missense probably damaging 0.99
R4767:Ephb6 UTSW 6 41614185 missense possibly damaging 0.81
R4780:Ephb6 UTSW 6 41616139 missense probably damaging 1.00
R4846:Ephb6 UTSW 6 41616809 missense probably benign
R4851:Ephb6 UTSW 6 41618145 missense probably benign 0.00
R5016:Ephb6 UTSW 6 41618107 missense probably benign 0.01
R5122:Ephb6 UTSW 6 41613404 missense probably benign 0.00
R5313:Ephb6 UTSW 6 41616793 missense possibly damaging 0.68
R5615:Ephb6 UTSW 6 41619291 missense probably benign
R5623:Ephb6 UTSW 6 41616481 missense probably benign 0.20
R5686:Ephb6 UTSW 6 41619704 missense possibly damaging 0.57
R6147:Ephb6 UTSW 6 41616781 missense probably damaging 1.00
R6645:Ephb6 UTSW 6 41617272 missense probably benign 0.01
R6730:Ephb6 UTSW 6 41617374 nonsense probably null
R7412:Ephb6 UTSW 6 41620239 missense probably damaging 1.00
R7442:Ephb6 UTSW 6 41618047 splice site probably null
R7759:Ephb6 UTSW 6 41614605 missense probably benign 0.00
R7857:Ephb6 UTSW 6 41613397 missense probably benign
R8425:Ephb6 UTSW 6 41618646 missense probably damaging 0.98
X0027:Ephb6 UTSW 6 41620080 makesense probably null
Predicted Primers PCR Primer
(F):5'- TATGCAGCCCAAAACAGGAG -3'
(R):5'- CTCAAGTGAACTCCAAAGACCTTTC -3'

Sequencing Primer
(F):5'- CCATCTCTGGGGAACAAAGGAC -3'
(R):5'- GTGAACTCCAAAGACCTTTCACTTC -3'
Posted On2016-12-20