Incidental Mutation 'R5840:Vmn1r172'
ID450372
Institutional Source Beutler Lab
Gene Symbol Vmn1r172
Ensembl Gene ENSMUSG00000035523
Gene Namevomeronasal 1 receptor 172
SynonymsV1rd9, V3R9
MMRRC Submission 044060-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R5840 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location23658316-23668447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23660175 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 162 (W162R)
Ref Sequence ENSEMBL: ENSMUSP00000133887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038694] [ENSMUST00000173101]
Predicted Effect probably benign
Transcript: ENSMUST00000038694
AA Change: W162R

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000041653
Gene: ENSMUSG00000035523
AA Change: W162R

DomainStartEndE-ValueType
Pfam:TAS2R 8 301 7.1e-9 PFAM
Pfam:7tm_1 30 268 3.6e-9 PFAM
Pfam:V1R 43 301 7.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173101
AA Change: W162R

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000133887
Gene: ENSMUSG00000035523
AA Change: W162R

DomainStartEndE-ValueType
Pfam:TAS2R 8 301 7.2e-9 PFAM
Pfam:V1R 43 301 7.2e-18 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 96.5%
  • 20x: 88.1%
Validation Efficiency 99% (75/76)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G A 2: 25,433,359 R113Q probably benign Het
Aip G A 19: 4,116,010 P147L possibly damaging Het
Anapc1 A C 2: 128,607,037 probably benign Het
Arhgap42 C T 9: 9,046,517 V240I possibly damaging Het
Axdnd1 T C 1: 156,348,958 E684G probably damaging Het
BC005624 G A 2: 30,981,857 R2W probably benign Het
Cd177 T G 7: 24,758,070 Q182P probably damaging Het
Cdca5 G A 19: 6,090,369 E187K possibly damaging Het
Chmp1a T C 8: 123,208,100 Q39R probably benign Het
Dab2ip A G 2: 35,727,499 I1079V probably damaging Het
Dip2c A T 13: 9,506,676 E85D possibly damaging Het
Elmo2 A T 2: 165,295,552 S497R possibly damaging Het
Ephb6 C T 6: 41,615,573 A339V possibly damaging Het
Foxred1 T C 9: 35,210,139 K38E probably damaging Het
Frem2 T A 3: 53,647,921 T1732S probably damaging Het
Fto A G 8: 91,666,440 probably benign Het
Gm17430 T A 18: 9,726,528 Q48L probably damaging Het
Gng2 A G 14: 19,875,814 I70T probably damaging Het
Gtf2a2 A G 9: 70,015,293 probably benign Het
Invs A G 4: 48,396,284 D263G probably damaging Het
Itga2b C T 11: 102,461,331 V475M probably damaging Het
Kansl1l A G 1: 66,770,215 probably benign Het
Klhl25 T C 7: 75,866,692 F449L possibly damaging Het
Lamb1 T A 12: 31,266,756 C83S probably damaging Het
Loxl4 G T 19: 42,598,715 T648K probably damaging Het
Lrit2 T C 14: 37,069,005 F214L possibly damaging Het
N4bp2 T G 5: 65,808,094 L1162R probably damaging Het
Naa40 A T 19: 7,230,008 I117N probably benign Het
Ncapd3 T C 9: 27,094,758 S1492P probably benign Het
Nf2 T A 11: 4,816,146 D128V probably benign Het
Nox4 T C 7: 87,360,793 S401P probably benign Het
Nt5c1b T C 12: 10,377,171 V323A probably damaging Het
Olfr1474 G A 19: 13,471,878 V303I probably benign Het
Olfr601 T A 7: 103,358,369 H275L probably damaging Het
Olfr622 C T 7: 103,639,256 V295I probably benign Het
Pcdhb14 T C 18: 37,448,750 V303A probably benign Het
Pde8a C A 7: 81,213,965 H17Q probably benign Het
Pfkl C T 10: 77,988,724 V716I probably benign Het
Phc3 G A 3: 30,936,583 S495L possibly damaging Het
Psg18 A G 7: 18,346,602 probably benign Het
Rcc2 T G 4: 140,712,138 N175K possibly damaging Het
Rhot2 G A 17: 25,840,058 T276I probably benign Het
Rnase9 A T 14: 51,038,988 Y178N probably benign Het
Sema4b T C 7: 80,218,949 C297R probably damaging Het
Slc35d2 T C 13: 64,118,413 probably null Het
Sptlc3 A T 2: 139,547,206 N169Y probably damaging Het
Srsf9 T G 5: 115,331,465 M29R probably benign Het
Stip1 C A 19: 7,022,068 D449Y possibly damaging Het
Syne2 T A 12: 75,880,291 probably null Het
Tgm5 A G 2: 121,085,660 probably null Het
Thbs2 A T 17: 14,681,430 probably null Het
Trak2 T C 1: 58,919,273 E283G probably damaging Het
Trbv21 A G 6: 41,202,858 Y36C probably damaging Het
Trpm7 A T 2: 126,822,611 Y949* probably null Het
Ubqln5 T C 7: 104,128,954 D221G possibly damaging Het
Ubxn4 T A 1: 128,259,525 V85D possibly damaging Het
Vrk2 A G 11: 26,534,314 probably benign Het
Zc3h8 A C 2: 128,929,904 D276E probably benign Het
Zfp369 C T 13: 65,297,278 T745I possibly damaging Het
Zfp608 T C 18: 54,898,906 K654R probably damaging Het
Other mutations in Vmn1r172
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02295:Vmn1r172 APN 7 23659917 missense probably benign 0.30
IGL02407:Vmn1r172 APN 7 23659803 missense probably damaging 1.00
IGL02540:Vmn1r172 APN 7 23659925 missense probably benign 0.25
IGL03090:Vmn1r172 APN 7 23660038 missense probably damaging 0.98
R0396:Vmn1r172 UTSW 7 23660532 missense probably benign 0.06
R1087:Vmn1r172 UTSW 7 23660248 missense possibly damaging 0.92
R1502:Vmn1r172 UTSW 7 23660256 nonsense probably null
R1701:Vmn1r172 UTSW 7 23660104 missense probably damaging 1.00
R1882:Vmn1r172 UTSW 7 23660226 missense probably damaging 1.00
R2272:Vmn1r172 UTSW 7 23660191 missense probably damaging 0.98
R4646:Vmn1r172 UTSW 7 23660494 missense probably benign 0.03
R4653:Vmn1r172 UTSW 7 23660572 missense probably damaging 0.96
R4709:Vmn1r172 UTSW 7 23660181 missense probably benign 0.25
R4937:Vmn1r172 UTSW 7 23659887 missense possibly damaging 0.92
R4945:Vmn1r172 UTSW 7 23660320 missense possibly damaging 0.79
R6154:Vmn1r172 UTSW 7 23660158 missense probably damaging 0.96
R6317:Vmn1r172 UTSW 7 23660317 missense probably damaging 1.00
R7206:Vmn1r172 UTSW 7 23660157 missense possibly damaging 0.69
R7290:Vmn1r172 UTSW 7 23660623 missense unknown
R7362:Vmn1r172 UTSW 7 23660416 missense probably damaging 1.00
R7369:Vmn1r172 UTSW 7 23660605 missense unknown
R7528:Vmn1r172 UTSW 7 23659764 missense probably damaging 1.00
U24488:Vmn1r172 UTSW 7 23659746 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAGCTTGAGTACTTCATTCGTCTG -3'
(R):5'- ACCTGTGAATGTGTTTCAGGC -3'

Sequencing Primer
(F):5'- CTCGAAGTGCAAACATGTGTAC -3'
(R):5'- CAGGCTTTGGTGATGTCTATACAAG -3'
Posted On2016-12-20