Incidental Mutation 'R5840:Ubqln5'
ID450380
Institutional Source Beutler Lab
Gene Symbol Ubqln5
Ensembl Gene ENSMUSG00000055643
Gene Nameubiquilin 5
Synonyms4931431F19Rik
MMRRC Submission 044060-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5840 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104127912-104129826 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104128954 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 221 (D221G)
Ref Sequence ENSEMBL: ENSMUSP00000062054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053743] [ENSMUST00000138055]
PDB Structure
Solution Structure of RSGI RUH-016, a UBA Domain from mouse cDNA [SOLUTION NMR]
Solution Structure of the N-terminal Ubiquitin-like Domain in the 4931431F19Rik Protein [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053743
AA Change: D221G

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062054
Gene: ENSMUSG00000055643
AA Change: D221G

DomainStartEndE-ValueType
UBQ 24 94 7.97e-13 SMART
low complexity region 365 376 N/A INTRINSIC
UBA 468 506 2.14e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 96.5%
  • 20x: 88.1%
Validation Efficiency 99% (75/76)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G A 2: 25,433,359 R113Q probably benign Het
Aip G A 19: 4,116,010 P147L possibly damaging Het
Anapc1 A C 2: 128,607,037 probably benign Het
Arhgap42 C T 9: 9,046,517 V240I possibly damaging Het
Axdnd1 T C 1: 156,348,958 E684G probably damaging Het
BC005624 G A 2: 30,981,857 R2W probably benign Het
Cd177 T G 7: 24,758,070 Q182P probably damaging Het
Cdca5 G A 19: 6,090,369 E187K possibly damaging Het
Chmp1a T C 8: 123,208,100 Q39R probably benign Het
Dab2ip A G 2: 35,727,499 I1079V probably damaging Het
Dip2c A T 13: 9,506,676 E85D possibly damaging Het
Elmo2 A T 2: 165,295,552 S497R possibly damaging Het
Ephb6 C T 6: 41,615,573 A339V possibly damaging Het
Foxred1 T C 9: 35,210,139 K38E probably damaging Het
Frem2 T A 3: 53,647,921 T1732S probably damaging Het
Fto A G 8: 91,666,440 probably benign Het
Gm17430 T A 18: 9,726,528 Q48L probably damaging Het
Gng2 A G 14: 19,875,814 I70T probably damaging Het
Gtf2a2 A G 9: 70,015,293 probably benign Het
Invs A G 4: 48,396,284 D263G probably damaging Het
Itga2b C T 11: 102,461,331 V475M probably damaging Het
Kansl1l A G 1: 66,770,215 probably benign Het
Klhl25 T C 7: 75,866,692 F449L possibly damaging Het
Lamb1 T A 12: 31,266,756 C83S probably damaging Het
Loxl4 G T 19: 42,598,715 T648K probably damaging Het
Lrit2 T C 14: 37,069,005 F214L possibly damaging Het
N4bp2 T G 5: 65,808,094 L1162R probably damaging Het
Naa40 A T 19: 7,230,008 I117N probably benign Het
Ncapd3 T C 9: 27,094,758 S1492P probably benign Het
Nf2 T A 11: 4,816,146 D128V probably benign Het
Nox4 T C 7: 87,360,793 S401P probably benign Het
Nt5c1b T C 12: 10,377,171 V323A probably damaging Het
Olfr1474 G A 19: 13,471,878 V303I probably benign Het
Olfr601 T A 7: 103,358,369 H275L probably damaging Het
Olfr622 C T 7: 103,639,256 V295I probably benign Het
Pcdhb14 T C 18: 37,448,750 V303A probably benign Het
Pde8a C A 7: 81,213,965 H17Q probably benign Het
Pfkl C T 10: 77,988,724 V716I probably benign Het
Phc3 G A 3: 30,936,583 S495L possibly damaging Het
Psg18 A G 7: 18,346,602 probably benign Het
Rcc2 T G 4: 140,712,138 N175K possibly damaging Het
Rhot2 G A 17: 25,840,058 T276I probably benign Het
Rnase9 A T 14: 51,038,988 Y178N probably benign Het
Sema4b T C 7: 80,218,949 C297R probably damaging Het
Slc35d2 T C 13: 64,118,413 probably null Het
Sptlc3 A T 2: 139,547,206 N169Y probably damaging Het
Srsf9 T G 5: 115,331,465 M29R probably benign Het
Stip1 C A 19: 7,022,068 D449Y possibly damaging Het
Syne2 T A 12: 75,880,291 probably null Het
Tgm5 A G 2: 121,085,660 probably null Het
Thbs2 A T 17: 14,681,430 probably null Het
Trak2 T C 1: 58,919,273 E283G probably damaging Het
Trbv21 A G 6: 41,202,858 Y36C probably damaging Het
Trpm7 A T 2: 126,822,611 Y949* probably null Het
Ubxn4 T A 1: 128,259,525 V85D possibly damaging Het
Vmn1r172 T A 7: 23,660,175 W162R probably benign Het
Vrk2 A G 11: 26,534,314 probably benign Het
Zc3h8 A C 2: 128,929,904 D276E probably benign Het
Zfp369 C T 13: 65,297,278 T745I possibly damaging Het
Zfp608 T C 18: 54,898,906 K654R probably damaging Het
Other mutations in Ubqln5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Ubqln5 APN 7 104128427 missense possibly damaging 0.83
IGL02127:Ubqln5 APN 7 104129482 missense probably damaging 0.99
IGL02565:Ubqln5 APN 7 104129072 nonsense probably null
R1181:Ubqln5 UTSW 7 104128741 missense probably damaging 0.99
R1962:Ubqln5 UTSW 7 104128888 missense possibly damaging 0.83
R1962:Ubqln5 UTSW 7 104128927 missense probably damaging 0.98
R1964:Ubqln5 UTSW 7 104128888 missense possibly damaging 0.83
R1992:Ubqln5 UTSW 7 104129534 missense probably damaging 1.00
R1998:Ubqln5 UTSW 7 104128741 missense probably damaging 0.99
R3927:Ubqln5 UTSW 7 104128471 missense probably damaging 1.00
R4831:Ubqln5 UTSW 7 104129622 intron probably benign
R5699:Ubqln5 UTSW 7 104129425 missense possibly damaging 0.78
R5858:Ubqln5 UTSW 7 104128811 missense probably benign 0.17
R5907:Ubqln5 UTSW 7 104128574 missense possibly damaging 0.55
R6477:Ubqln5 UTSW 7 104128258 missense probably damaging 0.97
R6602:Ubqln5 UTSW 7 104129489 missense probably benign 0.07
R6919:Ubqln5 UTSW 7 104129008 missense probably benign 0.15
R6981:Ubqln5 UTSW 7 104128601 missense probably benign 0.29
R8153:Ubqln5 UTSW 7 104128804 missense possibly damaging 0.52
X0028:Ubqln5 UTSW 7 104129408 missense probably damaging 1.00
Z1088:Ubqln5 UTSW 7 104128971 missense possibly damaging 0.83
Z1176:Ubqln5 UTSW 7 104128918 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TCTTGTGCCAAGGTCCTGAC -3'
(R):5'- TGGTGCAACTCTTGGAAGATC -3'

Sequencing Primer
(F):5'- TCCTGACCAGAGGAGAAGTG -3'
(R):5'- GAAGATCCTCTGATTCAAGGCCTG -3'
Posted On2016-12-20