Incidental Mutation 'R5840:Fto'
ID450381
Institutional Source Beutler Lab
Gene Symbol Fto
Ensembl Gene ENSMUSG00000055932
Gene Namefat mass and obesity associated
Synonyms
MMRRC Submission 044060-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5840 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location91313525-91668439 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to G at 91666440 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000068380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069718]
Predicted Effect probably benign
Transcript: ENSMUST00000069718
SMART Domains Protein: ENSMUSP00000068380
Gene: ENSMUSG00000055932

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
FTO_NTD 35 323 2.71e-191 SMART
Pfam:FTO_CTD 326 495 1.1e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210393
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 96.5%
  • 20x: 88.1%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a nuclear protein of the AlkB related non-haem iron and 2-oxoglutarate-dependent oxygenase superfamily but the exact physiological function of this gene is not known. Other non-heme iron enzymes function to reverse alkylated DNA and RNA damage by oxidative demethylation. Studies in mice and humans indicate a role in nervous and cardiovascular systems and a strong association with body mass index, obesity risk, and type 2 diabetes. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for an ENU-induced or targeted knock-out allele exhibit decreased body weight, adipose tissue, and body fat and increased metabolism, serum lipids, and serum glucagon that may be gender and diet dependent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G A 2: 25,433,359 R113Q probably benign Het
Aip G A 19: 4,116,010 P147L possibly damaging Het
Anapc1 A C 2: 128,607,037 probably benign Het
Arhgap42 C T 9: 9,046,517 V240I possibly damaging Het
Axdnd1 T C 1: 156,348,958 E684G probably damaging Het
BC005624 G A 2: 30,981,857 R2W probably benign Het
Cd177 T G 7: 24,758,070 Q182P probably damaging Het
Cdca5 G A 19: 6,090,369 E187K possibly damaging Het
Chmp1a T C 8: 123,208,100 Q39R probably benign Het
Dab2ip A G 2: 35,727,499 I1079V probably damaging Het
Dip2c A T 13: 9,506,676 E85D possibly damaging Het
Elmo2 A T 2: 165,295,552 S497R possibly damaging Het
Ephb6 C T 6: 41,615,573 A339V possibly damaging Het
Foxred1 T C 9: 35,210,139 K38E probably damaging Het
Frem2 T A 3: 53,647,921 T1732S probably damaging Het
Gm17430 T A 18: 9,726,528 Q48L probably damaging Het
Gng2 A G 14: 19,875,814 I70T probably damaging Het
Gtf2a2 A G 9: 70,015,293 probably benign Het
Invs A G 4: 48,396,284 D263G probably damaging Het
Itga2b C T 11: 102,461,331 V475M probably damaging Het
Kansl1l A G 1: 66,770,215 probably benign Het
Klhl25 T C 7: 75,866,692 F449L possibly damaging Het
Lamb1 T A 12: 31,266,756 C83S probably damaging Het
Loxl4 G T 19: 42,598,715 T648K probably damaging Het
Lrit2 T C 14: 37,069,005 F214L possibly damaging Het
N4bp2 T G 5: 65,808,094 L1162R probably damaging Het
Naa40 A T 19: 7,230,008 I117N probably benign Het
Ncapd3 T C 9: 27,094,758 S1492P probably benign Het
Nf2 T A 11: 4,816,146 D128V probably benign Het
Nox4 T C 7: 87,360,793 S401P probably benign Het
Nt5c1b T C 12: 10,377,171 V323A probably damaging Het
Olfr1474 G A 19: 13,471,878 V303I probably benign Het
Olfr601 T A 7: 103,358,369 H275L probably damaging Het
Olfr622 C T 7: 103,639,256 V295I probably benign Het
Pcdhb14 T C 18: 37,448,750 V303A probably benign Het
Pde8a C A 7: 81,213,965 H17Q probably benign Het
Pfkl C T 10: 77,988,724 V716I probably benign Het
Phc3 G A 3: 30,936,583 S495L possibly damaging Het
Psg18 A G 7: 18,346,602 probably benign Het
Rcc2 T G 4: 140,712,138 N175K possibly damaging Het
Rhot2 G A 17: 25,840,058 T276I probably benign Het
Rnase9 A T 14: 51,038,988 Y178N probably benign Het
Sema4b T C 7: 80,218,949 C297R probably damaging Het
Slc35d2 T C 13: 64,118,413 probably null Het
Sptlc3 A T 2: 139,547,206 N169Y probably damaging Het
Srsf9 T G 5: 115,331,465 M29R probably benign Het
Stip1 C A 19: 7,022,068 D449Y possibly damaging Het
Syne2 T A 12: 75,880,291 probably null Het
Tgm5 A G 2: 121,085,660 probably null Het
Thbs2 A T 17: 14,681,430 probably null Het
Trak2 T C 1: 58,919,273 E283G probably damaging Het
Trbv21 A G 6: 41,202,858 Y36C probably damaging Het
Trpm7 A T 2: 126,822,611 Y949* probably null Het
Ubqln5 T C 7: 104,128,954 D221G possibly damaging Het
Ubxn4 T A 1: 128,259,525 V85D possibly damaging Het
Vmn1r172 T A 7: 23,660,175 W162R probably benign Het
Vrk2 A G 11: 26,534,314 probably benign Het
Zc3h8 A C 2: 128,929,904 D276E probably benign Het
Zfp369 C T 13: 65,297,278 T745I possibly damaging Het
Zfp608 T C 18: 54,898,906 K654R probably damaging Het
Other mutations in Fto
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Fto APN 8 91441716 missense probably benign 0.29
IGL01541:Fto APN 8 91409748 missense probably damaging 1.00
IGL01636:Fto APN 8 91409341 missense probably damaging 1.00
IGL01788:Fto APN 8 91409731 missense probably benign 0.25
IGL02016:Fto APN 8 91666406 nonsense probably null
IGL02365:Fto APN 8 91468375 missense probably damaging 1.00
IGL02639:Fto APN 8 91409528 missense probably damaging 1.00
IGL02926:Fto APN 8 91485167 missense probably damaging 1.00
IGL03194:Fto APN 8 91409787 missense probably damaging 1.00
R0091:Fto UTSW 8 91441807 critical splice donor site probably null
R0105:Fto UTSW 8 91522802 missense probably damaging 1.00
R0326:Fto UTSW 8 91409527 missense probably damaging 1.00
R0332:Fto UTSW 8 91401890 splice site probably benign
R0378:Fto UTSW 8 91474312 missense probably damaging 1.00
R0601:Fto UTSW 8 91401802 splice site probably null
R1526:Fto UTSW 8 91441686 missense possibly damaging 0.90
R2092:Fto UTSW 8 91409687 nonsense probably null
R4731:Fto UTSW 8 91409714 missense probably damaging 1.00
R4732:Fto UTSW 8 91409714 missense probably damaging 1.00
R4733:Fto UTSW 8 91409714 missense probably damaging 1.00
R5347:Fto UTSW 8 91391479 intron probably benign
R7213:Fto UTSW 8 91391507 missense probably benign 0.00
R7271:Fto UTSW 8 91485190 missense probably damaging 1.00
R7658:Fto UTSW 8 91666322 missense probably benign 0.34
R7763:Fto UTSW 8 91409443 missense probably damaging 0.99
R8110:Fto UTSW 8 91485190 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGACTAACTGCCTGCTCTTC -3'
(R):5'- ACAAAAGGGCTCCAGGTGTG -3'

Sequencing Primer
(F):5'- GCTCTTCTTCTCCTAGGTGCCAG -3'
(R):5'- GAGGGGTGCTCTAATTTAACACC -3'
Posted On2016-12-20