Incidental Mutation 'R5840:Or5b118'
ID 450409
Institutional Source Beutler Lab
Gene Symbol Or5b118
Ensembl Gene ENSMUSG00000096273
Gene Name olfactory receptor family 5 subfamily B member 118
Synonyms Olfr1474, MOR202-26P, GA_x6K02T2RE5P-3803583-3804527, MOR202-42
MMRRC Submission 044060-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R5840 (G1)
Quality Score 215
Status Validated
Chromosome 19
Chromosomal Location 13448336-13449280 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 13449242 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 303 (V303I)
Ref Sequence ENSEMBL: ENSMUSP00000151810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096202] [ENSMUST00000207529] [ENSMUST00000220113]
AlphaFold Q7TQQ8
Predicted Effect probably benign
Transcript: ENSMUST00000096202
AA Change: V303I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000093916
Gene: ENSMUSG00000096273
AA Change: V303I

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.6e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 303 1e-7 PFAM
Pfam:7tm_1 39 288 8.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207529
Predicted Effect probably benign
Transcript: ENSMUST00000220113
AA Change: V303I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 96.5%
  • 20x: 88.1%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI

none

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G A 2: 25,323,371 (GRCm39) R113Q probably benign Het
Aip G A 19: 4,166,010 (GRCm39) P147L possibly damaging Het
Anapc1 A C 2: 128,448,957 (GRCm39) probably benign Het
Arhgap42 C T 9: 9,046,518 (GRCm39) V240I possibly damaging Het
Axdnd1 T C 1: 156,176,528 (GRCm39) E684G probably damaging Het
BC005624 G A 2: 30,871,869 (GRCm39) R2W probably benign Het
Cd177 T G 7: 24,457,495 (GRCm39) Q182P probably damaging Het
Cdca5 G A 19: 6,140,399 (GRCm39) E187K possibly damaging Het
Chmp1a T C 8: 123,934,839 (GRCm39) Q39R probably benign Het
Dab2ip A G 2: 35,617,511 (GRCm39) I1079V probably damaging Het
Dip2c A T 13: 9,556,712 (GRCm39) E85D possibly damaging Het
Elmo2 A T 2: 165,137,472 (GRCm39) S497R possibly damaging Het
Ephb6 C T 6: 41,592,507 (GRCm39) A339V possibly damaging Het
Foxred1 T C 9: 35,121,435 (GRCm39) K38E probably damaging Het
Frem2 T A 3: 53,555,342 (GRCm39) T1732S probably damaging Het
Fto A G 8: 92,393,068 (GRCm39) probably benign Het
Gm17430 T A 18: 9,726,528 (GRCm39) Q48L probably damaging Het
Gng2 A G 14: 19,925,882 (GRCm39) I70T probably damaging Het
Gtf2a2 A G 9: 69,922,575 (GRCm39) probably benign Het
Invs A G 4: 48,396,284 (GRCm39) D263G probably damaging Het
Itga2b C T 11: 102,352,157 (GRCm39) V475M probably damaging Het
Kansl1l A G 1: 66,809,374 (GRCm39) probably benign Het
Klhl25 T C 7: 75,516,440 (GRCm39) F449L possibly damaging Het
Lamb1 T A 12: 31,316,755 (GRCm39) C83S probably damaging Het
Loxl4 G T 19: 42,587,154 (GRCm39) T648K probably damaging Het
Lrit2 T C 14: 36,790,962 (GRCm39) F214L possibly damaging Het
N4bp2 T G 5: 65,965,437 (GRCm39) L1162R probably damaging Het
Naa40 A T 19: 7,207,373 (GRCm39) I117N probably benign Het
Ncapd3 T C 9: 27,006,054 (GRCm39) S1492P probably benign Het
Nf2 T A 11: 4,766,146 (GRCm39) D128V probably benign Het
Nox4 T C 7: 87,010,001 (GRCm39) S401P probably benign Het
Nt5c1b T C 12: 10,427,171 (GRCm39) V323A probably damaging Het
Or52a33 C T 7: 103,288,463 (GRCm39) V295I probably benign Het
Or52s19 T A 7: 103,007,576 (GRCm39) H275L probably damaging Het
Pcdhb14 T C 18: 37,581,803 (GRCm39) V303A probably benign Het
Pde8a C A 7: 80,863,713 (GRCm39) H17Q probably benign Het
Pfkl C T 10: 77,824,558 (GRCm39) V716I probably benign Het
Phc3 G A 3: 30,990,732 (GRCm39) S495L possibly damaging Het
Psg18 A G 7: 18,080,527 (GRCm39) probably benign Het
Rcc2 T G 4: 140,439,449 (GRCm39) N175K possibly damaging Het
Rhot2 G A 17: 26,059,032 (GRCm39) T276I probably benign Het
Rnase9 A T 14: 51,276,445 (GRCm39) Y178N probably benign Het
Sema4b T C 7: 79,868,697 (GRCm39) C297R probably damaging Het
Slc35d2 T C 13: 64,266,227 (GRCm39) probably null Het
Sptlc3 A T 2: 139,389,126 (GRCm39) N169Y probably damaging Het
Srsf9 T G 5: 115,469,524 (GRCm39) M29R probably benign Het
Stip1 C A 19: 6,999,436 (GRCm39) D449Y possibly damaging Het
Syne2 T A 12: 75,927,065 (GRCm39) probably null Het
Tgm5 A G 2: 120,916,141 (GRCm39) probably null Het
Thbs2 A T 17: 14,901,692 (GRCm39) probably null Het
Trak2 T C 1: 58,958,432 (GRCm39) E283G probably damaging Het
Trbv21 A G 6: 41,179,792 (GRCm39) Y36C probably damaging Het
Trpm7 A T 2: 126,664,531 (GRCm39) Y949* probably null Het
Ubqln5 T C 7: 103,778,161 (GRCm39) D221G possibly damaging Het
Ubxn4 T A 1: 128,187,262 (GRCm39) V85D possibly damaging Het
Vmn1r172 T A 7: 23,359,600 (GRCm39) W162R probably benign Het
Vrk2 A G 11: 26,484,314 (GRCm39) probably benign Het
Zc3h8 A C 2: 128,771,824 (GRCm39) D276E probably benign Het
Zfp369 C T 13: 65,445,092 (GRCm39) T745I possibly damaging Het
Zfp608 T C 18: 55,031,978 (GRCm39) K654R probably damaging Het
Other mutations in Or5b118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03256:Or5b118 APN 19 13,448,631 (GRCm39) missense probably damaging 0.99
D605:Or5b118 UTSW 19 13,448,521 (GRCm39) nonsense probably null
R0173:Or5b118 UTSW 19 13,449,065 (GRCm39) missense probably benign 0.02
R1102:Or5b118 UTSW 19 13,448,771 (GRCm39) missense probably damaging 0.97
R1515:Or5b118 UTSW 19 13,449,044 (GRCm39) missense probably damaging 0.97
R1780:Or5b118 UTSW 19 13,448,726 (GRCm39) missense probably benign 0.14
R2061:Or5b118 UTSW 19 13,448,605 (GRCm39) missense probably damaging 0.98
R4016:Or5b118 UTSW 19 13,448,561 (GRCm39) missense possibly damaging 0.95
R4485:Or5b118 UTSW 19 13,448,919 (GRCm39) missense probably benign 0.08
R5119:Or5b118 UTSW 19 13,448,910 (GRCm39) missense probably benign 0.00
R5150:Or5b118 UTSW 19 13,448,794 (GRCm39) missense probably benign 0.01
R5156:Or5b118 UTSW 19 13,449,037 (GRCm39) missense probably damaging 1.00
R5699:Or5b118 UTSW 19 13,448,336 (GRCm39) start codon destroyed probably null 0.78
R5800:Or5b118 UTSW 19 13,449,260 (GRCm39) missense probably benign 0.06
R5953:Or5b118 UTSW 19 13,448,732 (GRCm39) missense possibly damaging 0.92
R5997:Or5b118 UTSW 19 13,448,870 (GRCm39) missense probably benign 0.12
R6233:Or5b118 UTSW 19 13,449,104 (GRCm39) missense probably damaging 1.00
R6488:Or5b118 UTSW 19 13,448,981 (GRCm39) missense probably damaging 1.00
R6847:Or5b118 UTSW 19 13,448,402 (GRCm39) missense probably benign 0.03
R6964:Or5b118 UTSW 19 13,448,725 (GRCm39) nonsense probably null
R7214:Or5b118 UTSW 19 13,448,337 (GRCm39) start codon destroyed probably null 1.00
R8001:Or5b118 UTSW 19 13,448,786 (GRCm39) missense probably benign 0.03
R8035:Or5b118 UTSW 19 13,449,263 (GRCm39) missense probably benign
R8129:Or5b118 UTSW 19 13,448,508 (GRCm39) missense probably damaging 1.00
R9018:Or5b118 UTSW 19 13,448,721 (GRCm39) missense possibly damaging 0.60
R9061:Or5b118 UTSW 19 13,448,523 (GRCm39) missense probably damaging 0.98
R9065:Or5b118 UTSW 19 13,448,670 (GRCm39) missense probably damaging 0.97
R9373:Or5b118 UTSW 19 13,449,216 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTATCCTGAGGATGCGTTCAGC -3'
(R):5'- GCCAATGCATGAAGTCAAAGTTCTC -3'

Sequencing Primer
(F):5'- AGGAAGGCCTTCTCTACCTGTG -3'
(R):5'- CATTTCACAGGCTTGAGAAA -3'
Posted On 2016-12-20