Incidental Mutation 'R0549:Pcca'
ID45041
Institutional Source Beutler Lab
Gene Symbol Pcca
Ensembl Gene ENSMUSG00000041650
Gene Namepropionyl-Coenzyme A carboxylase, alpha polypeptide
SynonymsC79630
MMRRC Submission 038741-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0549 (G1)
Quality Score187
Status Validated
Chromosome14
Chromosomal Location122534324-122891100 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 122638377 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000038374] [ENSMUST00000135578]
Predicted Effect probably benign
Transcript: ENSMUST00000038374
SMART Domains Protein: ENSMUSP00000038763
Gene: ENSMUSG00000041650

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 58 167 2.1e-48 PFAM
Pfam:ATP-grasp_4 169 351 3.8e-15 PFAM
Pfam:RimK 170 372 5.6e-7 PFAM
Pfam:CPSase_L_D2 172 381 2.8e-87 PFAM
Pfam:ATP-grasp 181 351 9.8e-10 PFAM
Pfam:Dala_Dala_lig_C 192 349 7.7e-12 PFAM
Biotin_carb_C 393 501 4.27e-46 SMART
Pfam:Biotin_lipoyl 656 723 1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135578
SMART Domains Protein: ENSMUSP00000123422
Gene: ENSMUSG00000041650

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 58 102 6.1e-15 PFAM
Pfam:CPSase_L_D2 116 163 9.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143240
Predicted Effect probably benign
Transcript: ENSMUST00000177312
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the alpha subunit of the heterodimeric mitochondrial enzyme Propionyl-CoA carboxylase. PCCA encodes the biotin-binding region of this enzyme. Mutations in either PCCA or PCCB (encoding the beta subunit) lead to an enzyme deficiency resulting in propionic acidemia. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice die 24-36 hours after birth due to accelerated ketoacidosis. Death is preceded by reduced milk intake, poor movement, dehydration, accumulation of propionyl-CoA, ketonuria, increased fat deposition and glycogen consumption in liver, and enlarged kidney collecting ducts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A G 17: 46,322,290 F498L probably damaging Het
Adamts6 A T 13: 104,297,255 D64V possibly damaging Het
Agbl2 T C 2: 90,789,843 probably benign Het
Angptl3 A G 4: 99,031,455 S151G probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
C4b G T 17: 34,735,415 L927I probably damaging Het
Ccl3 T C 11: 83,648,336 T66A probably damaging Het
Cdh7 T C 1: 110,108,944 L618P probably damaging Het
Cfap65 T C 1: 74,918,444 T989A probably benign Het
Cnpy4 T C 5: 138,187,637 F18S possibly damaging Het
Col6a5 A G 9: 105,904,579 probably benign Het
Dppa2 G A 16: 48,318,671 R289H probably benign Het
Evx2 T C 2: 74,659,134 T96A probably benign Het
Frmd4a A G 2: 4,603,967 E577G possibly damaging Het
Gcgr G A 11: 120,536,561 G166S probably benign Het
Gm4788 A T 1: 139,739,488 D377E probably damaging Het
Gm5316 T C 6: 122,900,191 noncoding transcript Het
Gria1 G A 11: 57,228,973 R292Q probably damaging Het
Hars2 T A 18: 36,786,208 probably null Het
Hkdc1 T A 10: 62,400,240 T508S probably benign Het
Kif2b A T 11: 91,576,584 I291N probably damaging Het
Lmbrd1 A T 1: 24,744,920 T377S probably benign Het
Lrrc28 A G 7: 67,628,342 probably benign Het
Mmp3 A T 9: 7,455,638 N463I probably benign Het
Myh6 A G 14: 54,958,608 F578S probably damaging Het
Ncbp1 T A 4: 46,168,476 M608K possibly damaging Het
Nf1 T C 11: 79,468,771 F1412L probably damaging Het
Nlrp5 T A 7: 23,441,802 W1083R probably damaging Het
Nrsn1 T C 13: 25,262,258 Y45C probably benign Het
Olfr401 T G 11: 74,121,475 M62R probably damaging Het
Osbpl7 G T 11: 97,067,542 R881L probably damaging Het
Papss1 A G 3: 131,619,213 E456G possibly damaging Het
Pbxip1 T A 3: 89,443,592 probably benign Het
Pde1a T A 2: 79,865,070 N511I probably damaging Het
Prpf39 A T 12: 65,056,256 I435F probably benign Het
Rnf213 C T 11: 119,465,082 T4117M probably damaging Het
Sel1l2 A T 2: 140,265,882 M216K probably damaging Het
Sidt2 A G 9: 45,953,119 probably null Het
Sirt3 A T 7: 140,869,487 probably null Het
Smpd4 T C 16: 17,639,312 V378A probably benign Het
Svil T A 18: 5,064,566 S642T possibly damaging Het
Tcp10a A G 17: 7,326,551 K92E probably benign Het
Tmem144 T C 3: 79,822,744 D233G probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnik T C 3: 28,570,920 S335P possibly damaging Het
Ush2a T C 1: 188,946,953 L4786P probably damaging Het
Utp11 A T 4: 124,686,079 probably benign Het
Vmn1r67 A G 7: 10,447,714 N241D probably damaging Het
Vmn2r11 A T 5: 109,052,097 C497S possibly damaging Het
Other mutations in Pcca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Pcca APN 14 122582629 missense probably benign 0.22
IGL00906:Pcca APN 14 122690133 missense probably benign 0.34
IGL00975:Pcca APN 14 122876900 missense probably damaging 1.00
IGL01329:Pcca APN 14 122690133 missense possibly damaging 0.50
IGL01353:Pcca APN 14 122582617 missense probably damaging 0.98
IGL01672:Pcca APN 14 122690145 missense probably benign 0.02
IGL02621:Pcca APN 14 122684979 missense probably damaging 0.99
IGL02695:Pcca APN 14 122582738 splice site probably benign
IGL02749:Pcca APN 14 122534388 missense probably benign 0.00
IGL02971:Pcca APN 14 122889533 missense probably damaging 0.96
IGL03290:Pcca APN 14 122585106 missense possibly damaging 0.52
IGL03052:Pcca UTSW 14 122887101 missense probably benign
PIT4812001:Pcca UTSW 14 122790382 missense probably benign 0.00
R0866:Pcca UTSW 14 122889545 missense possibly damaging 0.95
R1498:Pcca UTSW 14 122616818 missense probably damaging 1.00
R1749:Pcca UTSW 14 122701130 missense probably damaging 0.97
R2002:Pcca UTSW 14 122887065 missense probably benign 0.00
R2020:Pcca UTSW 14 122813222 missense possibly damaging 0.64
R2086:Pcca UTSW 14 122686115 missense probably damaging 0.99
R3780:Pcca UTSW 14 122684885 missense probably damaging 1.00
R5023:Pcca UTSW 14 122790398 missense probably damaging 1.00
R5643:Pcca UTSW 14 122887069 missense probably damaging 1.00
R5644:Pcca UTSW 14 122887069 missense probably damaging 1.00
R5943:Pcca UTSW 14 122658776 missense probably damaging 0.99
R5966:Pcca UTSW 14 122668586 missense probably damaging 0.96
R6295:Pcca UTSW 14 122658775 missense probably benign 0.10
R6317:Pcca UTSW 14 122582623 missense probably damaging 1.00
R6319:Pcca UTSW 14 122582623 missense probably damaging 1.00
R6361:Pcca UTSW 14 122638382 missense probably benign 0.07
R6989:Pcca UTSW 14 122650288 missense probably damaging 1.00
R7243:Pcca UTSW 14 122876774 missense probably benign
R7841:Pcca UTSW 14 122562972 missense probably benign 0.03
R7924:Pcca UTSW 14 122562972 missense probably benign 0.03
RF024:Pcca UTSW 14 122684898 missense probably damaging 1.00
X0026:Pcca UTSW 14 122616791 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- CTGCACCGAATCATTGGCAATTCTG -3'
(R):5'- AGGGCACCTTCATTTGAATCCTGTG -3'

Sequencing Primer
(F):5'- GACGAAGGAGAATTTACATTCCAC -3'
(R):5'- TGTGTCCTTCACATTACAACAGAC -3'
Posted On2013-06-11