Incidental Mutation 'R5841:Ino80d'
ID450412
Institutional Source Beutler Lab
Gene Symbol Ino80d
Ensembl Gene ENSMUSG00000040865
Gene NameINO80 complex subunit D
SynonymsA430093A21Rik
MMRRC Submission 044061-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5841 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location62958418-63114667 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63058840 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 632 (S632P)
Ref Sequence ENSEMBL: ENSMUSP00000127378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097718] [ENSMUST00000133236] [ENSMUST00000137511] [ENSMUST00000153992] [ENSMUST00000165066] [ENSMUST00000172416]
Predicted Effect probably damaging
Transcript: ENSMUST00000097718
AA Change: S632P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095325
Gene: ENSMUSG00000040865
AA Change: S632P

DomainStartEndE-ValueType
low complexity region 91 101 N/A INTRINSIC
low complexity region 153 158 N/A INTRINSIC
low complexity region 249 260 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
Pfam:zf-C3Hc3H 336 402 1.2e-22 PFAM
low complexity region 414 459 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
low complexity region 647 666 N/A INTRINSIC
low complexity region 706 722 N/A INTRINSIC
low complexity region 802 821 N/A INTRINSIC
low complexity region 890 911 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000133236
AA Change: S632P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123430
Gene: ENSMUSG00000040865
AA Change: S632P

DomainStartEndE-ValueType
low complexity region 91 101 N/A INTRINSIC
low complexity region 153 158 N/A INTRINSIC
low complexity region 249 260 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
Pfam:zf-C3Hc3H 337 401 4.3e-20 PFAM
low complexity region 414 459 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
low complexity region 647 666 N/A INTRINSIC
low complexity region 706 722 N/A INTRINSIC
low complexity region 802 821 N/A INTRINSIC
low complexity region 890 911 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137511
SMART Domains Protein: ENSMUSP00000119118
Gene: ENSMUSG00000040865

DomainStartEndE-ValueType
low complexity region 91 101 N/A INTRINSIC
low complexity region 153 158 N/A INTRINSIC
low complexity region 249 260 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
Pfam:zf-C3Hc3H 336 402 4.3e-23 PFAM
low complexity region 414 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153992
SMART Domains Protein: ENSMUSP00000115332
Gene: ENSMUSG00000040865

DomainStartEndE-ValueType
low complexity region 91 101 N/A INTRINSIC
low complexity region 153 158 N/A INTRINSIC
low complexity region 249 260 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
Pfam:zf-C3Hc3H 336 402 4.3e-23 PFAM
low complexity region 414 431 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165066
AA Change: S737P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130864
Gene: ENSMUSG00000040865
AA Change: S737P

DomainStartEndE-ValueType
Pfam:zf-C3Hc3H 18 79 5.9e-21 PFAM
low complexity region 196 206 N/A INTRINSIC
low complexity region 258 263 N/A INTRINSIC
low complexity region 354 365 N/A INTRINSIC
low complexity region 419 430 N/A INTRINSIC
Pfam:zf-C3Hc3H 442 506 7e-21 PFAM
low complexity region 519 564 N/A INTRINSIC
low complexity region 640 654 N/A INTRINSIC
low complexity region 752 771 N/A INTRINSIC
low complexity region 811 827 N/A INTRINSIC
low complexity region 907 926 N/A INTRINSIC
low complexity region 995 1016 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172416
AA Change: S632P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127378
Gene: ENSMUSG00000040865
AA Change: S632P

DomainStartEndE-ValueType
low complexity region 91 101 N/A INTRINSIC
low complexity region 153 158 N/A INTRINSIC
low complexity region 249 260 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
Pfam:zf-C3Hc3H 336 402 1.2e-22 PFAM
low complexity region 414 459 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
low complexity region 647 666 N/A INTRINSIC
low complexity region 706 722 N/A INTRINSIC
low complexity region 802 821 N/A INTRINSIC
low complexity region 890 911 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188100
Meta Mutation Damage Score 0.0603 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A T 1: 75,174,350 F565L possibly damaging Het
Abhd6 T A 14: 8,049,596 V188D probably benign Het
Bbs12 T G 3: 37,319,521 N39K probably benign Het
Bend5 A G 4: 111,433,470 Y221C probably damaging Het
Brd8 A G 18: 34,605,523 S683P probably damaging Het
Caskin1 A G 17: 24,496,209 D79G probably damaging Het
Cdyl T C 13: 35,872,561 L509P probably damaging Het
Cenpf G T 1: 189,657,444 T1397N possibly damaging Het
Ckap5 T A 2: 91,600,682 M1479K probably benign Het
Cpsf2 T C 12: 101,985,238 S145P probably damaging Het
Cyp4a12a A T 4: 115,326,702 H235L probably benign Het
Cyp7b1 A T 3: 18,097,506 F181Y probably damaging Het
Dennd5b T C 6: 149,044,755 T453A probably benign Het
Dlgap3 A G 4: 127,195,400 D263G probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Dync2li1 G A 17: 84,633,562 G69R probably damaging Het
Edc3 T C 9: 57,744,602 V331A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ganc C T 2: 120,411,539 T66I possibly damaging Het
Gm11595 C A 11: 99,772,317 C179F unknown Het
Gm13088 A G 4: 143,655,539 S196P possibly damaging Het
Gm15448 T A 7: 3,822,899 R324* probably null Het
Gnptg A G 17: 25,235,417 S159P probably damaging Het
Gsdmc2 C T 15: 63,826,210 V349I probably benign Het
Hydin T C 8: 110,533,214 I2606T possibly damaging Het
Kcnn2 G A 18: 45,559,396 R13H probably benign Het
Klb A T 5: 65,379,324 K666* probably null Het
Kmt2d G A 15: 98,852,109 probably benign Het
Kpna7 T C 5: 144,993,956 I360V possibly damaging Het
Lmbrd2 A G 15: 9,182,570 K576E possibly damaging Het
Lrp2 T A 2: 69,480,153 Y2692F probably benign Het
Meis2 T A 2: 116,058,664 E202D probably benign Het
Mgat4c A T 10: 102,388,965 T347S probably damaging Het
Mmp12 G A 9: 7,347,501 C26Y possibly damaging Het
Mrpl24 G A 3: 87,922,985 R145Q probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Mycbpap T A 11: 94,505,610 R135W probably damaging Het
Myo1g T A 11: 6,507,000 Y942F probably benign Het
Myrf T C 19: 10,223,547 K52R probably null Het
Ncf2 A T 1: 152,821,518 silent Het
Olfr585 T C 7: 103,097,954 F71S probably damaging Het
Otx1 T C 11: 21,998,594 probably benign Het
Pcnx T A 12: 81,918,655 V532D possibly damaging Het
Pik3r5 T C 11: 68,492,270 L305P probably damaging Het
Polr3a A T 14: 24,450,698 C1341S probably benign Het
Ppp1r3a T C 6: 14,718,984 T644A probably benign Het
Ptbp1 A G 10: 79,859,932 D289G probably benign Het
Pwp2 A G 10: 78,172,118 F868L probably benign Het
Rgs8 A G 1: 153,692,828 E153G probably damaging Het
Rhbdf2 G A 11: 116,602,354 probably benign Het
Sbf1 T C 15: 89,308,068 H78R probably damaging Het
Sdr16c6 C T 4: 4,062,728 A197T possibly damaging Het
Slc36a3 A T 11: 55,125,721 Y349* probably null Het
Slc38a9 T C 13: 112,695,322 L202P possibly damaging Het
Slc40a1 A T 1: 45,912,349 M216K probably damaging Het
Slc9a3r2 A T 17: 24,644,877 M8K probably benign Het
Srebf1 T A 11: 60,203,584 Q568H possibly damaging Het
Srp54b A G 12: 55,252,829 N315S probably benign Het
Strc A G 2: 121,365,877 F1557L probably benign Het
Susd3 C A 13: 49,238,726 probably benign Het
Usp54 G A 14: 20,550,283 T1462I probably benign Het
Vmn1r11 T A 6: 57,137,802 N150K probably damaging Het
Vwa8 C T 14: 78,994,518 H606Y probably benign Het
Zmym6 A G 4: 127,100,670 I206V possibly damaging Het
Other mutations in Ino80d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Ino80d APN 1 63093303 missense probably damaging 1.00
IGL01552:Ino80d APN 1 63057977 utr 3 prime probably benign
IGL01960:Ino80d APN 1 63058147 missense probably damaging 0.98
IGL02374:Ino80d APN 1 63086061 missense possibly damaging 0.63
IGL03201:Ino80d APN 1 63058308 missense probably damaging 1.00
IGL03248:Ino80d APN 1 63068182 critical splice donor site probably null
Creepy UTSW 1 63079047 missense possibly damaging 0.88
Friable UTSW 1 63062126 missense probably damaging 1.00
Herpes UTSW 1 63065834 missense probably damaging 1.00
PIT4696001:Ino80d UTSW 1 63085986 missense probably benign
R0153:Ino80d UTSW 1 63058318 missense probably damaging 0.97
R0371:Ino80d UTSW 1 63057956 utr 3 prime probably benign
R0416:Ino80d UTSW 1 63086276 missense possibly damaging 0.93
R1738:Ino80d UTSW 1 63093465 missense probably damaging 1.00
R2341:Ino80d UTSW 1 63065826 missense possibly damaging 0.75
R2351:Ino80d UTSW 1 63085835 missense probably benign 0.00
R2870:Ino80d UTSW 1 63061039 critical splice donor site probably null
R2870:Ino80d UTSW 1 63061039 critical splice donor site probably null
R3814:Ino80d UTSW 1 63074424 missense probably benign 0.05
R3828:Ino80d UTSW 1 63062078 missense possibly damaging 0.94
R3947:Ino80d UTSW 1 63074503 missense probably benign 0.16
R3949:Ino80d UTSW 1 63074503 missense probably benign 0.16
R5180:Ino80d UTSW 1 63086329 start gained probably benign
R5301:Ino80d UTSW 1 63074419 missense probably benign
R5338:Ino80d UTSW 1 63058939 missense probably benign 0.34
R5634:Ino80d UTSW 1 63062283 intron probably benign
R5716:Ino80d UTSW 1 63058697 missense probably benign 0.01
R6219:Ino80d UTSW 1 63079047 missense possibly damaging 0.88
R6222:Ino80d UTSW 1 63058525 missense probably damaging 0.99
R6283:Ino80d UTSW 1 63062126 missense probably damaging 1.00
R6720:Ino80d UTSW 1 63058610 missense probably damaging 1.00
R6835:Ino80d UTSW 1 63074326 missense probably benign
R6897:Ino80d UTSW 1 63065834 missense probably damaging 1.00
R7162:Ino80d UTSW 1 63065735 missense probably damaging 1.00
R7403:Ino80d UTSW 1 63062219 missense possibly damaging 0.52
R7644:Ino80d UTSW 1 63058771 missense probably benign 0.18
R7816:Ino80d UTSW 1 63086397 missense probably damaging 1.00
R8054:Ino80d UTSW 1 63058678 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ATAAGGTCGTCTGCCTTGC -3'
(R):5'- ACTTTCCCAGTCAGACGGTG -3'

Sequencing Primer
(F):5'- GTCTGCCTTGCTCAGCAG -3'
(R):5'- CCGTTCAGGGGTTGTCAGATAGAG -3'
Posted On2016-12-20