Incidental Mutation 'R5841:Abcb6'
ID 450413
Institutional Source Beutler Lab
Gene Symbol Abcb6
Ensembl Gene ENSMUSG00000026198
Gene Name ATP-binding cassette, sub-family B member 6
Synonyms 1200005B17Rik
MMRRC Submission 044061-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.308) question?
Stock # R5841 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 75148361-75157036 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 75150994 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 565 (F565L)
Ref Sequence ENSEMBL: ENSMUSP00000027396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027394] [ENSMUST00000027396] [ENSMUST00000162768] [ENSMUST00000161215] [ENSMUST00000160439]
AlphaFold Q9DC29
Predicted Effect probably benign
Transcript: ENSMUST00000027394
SMART Domains Protein: ENSMUSP00000027394
Gene: ENSMUSG00000026197

DomainStartEndE-ValueType
ZnF_AN1 10 49 2e-4 SMART
low complexity region 54 66 N/A INTRINSIC
ZnF_AN1 100 139 6.69e-3 SMART
low complexity region 155 179 N/A INTRINSIC
UIM 197 216 1.3e-2 SMART
UIM 221 240 1.26e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000027396
AA Change: F565L

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027396
Gene: ENSMUSG00000026198
AA Change: F565L

DomainStartEndE-ValueType
Pfam:MTABC_N 6 255 7.8e-80 PFAM
Pfam:ABC_membrane 265 544 3.7e-34 PFAM
AAA 615 816 1.29e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161106
Predicted Effect probably benign
Transcript: ENSMUST00000162768
SMART Domains Protein: ENSMUSP00000124552
Gene: ENSMUSG00000026197

DomainStartEndE-ValueType
ZnF_AN1 10 49 2e-4 SMART
low complexity region 54 66 N/A INTRINSIC
ZnF_AN1 100 139 6.69e-3 SMART
low complexity region 155 179 N/A INTRINSIC
UIM 197 216 1.3e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161215
SMART Domains Protein: ENSMUSP00000124630
Gene: ENSMUSG00000026198

DomainStartEndE-ValueType
SCOP:d1jj7a_ 5 78 8e-23 SMART
Blast:AAA 23 71 9e-25 BLAST
PDB:3NHB|A 23 94 3e-36 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160439
SMART Domains Protein: ENSMUSP00000125086
Gene: ENSMUSG00000026197

DomainStartEndE-ValueType
ZnF_AN1 10 49 2e-4 SMART
low complexity region 54 66 N/A INTRINSIC
ZnF_AN1 100 139 6.69e-3 SMART
low complexity region 155 179 N/A INTRINSIC
UIM 197 216 1.3e-2 SMART
UIM 221 240 1.26e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186227
Meta Mutation Damage Score 0.1913 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This half-transporter likely plays a role in mitochondrial function. Localized to 2q26, this gene is considered a candidate gene for lethal neonatal metabolic syndrome, a disorder of mitochondrial function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display partial lethality, impaired stress erythropoiesis, and absence of ATP-dependent transport of Coproporphyrin III in mitochondria. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd6 T A 14: 8,049,596 (GRCm38) V188D probably benign Het
Bbs12 T G 3: 37,373,670 (GRCm39) N39K probably benign Het
Bend5 A G 4: 111,290,667 (GRCm39) Y221C probably damaging Het
Brd8 A G 18: 34,738,576 (GRCm39) S683P probably damaging Het
Caskin1 A G 17: 24,715,183 (GRCm39) D79G probably damaging Het
Cdyl T C 13: 36,056,544 (GRCm39) L509P probably damaging Het
Cenpf G T 1: 189,389,641 (GRCm39) T1397N possibly damaging Het
Ckap5 T A 2: 91,431,027 (GRCm39) M1479K probably benign Het
Cpsf2 T C 12: 101,951,497 (GRCm39) S145P probably damaging Het
Cyp4a12a A T 4: 115,183,899 (GRCm39) H235L probably benign Het
Cyp7b1 A T 3: 18,151,670 (GRCm39) F181Y probably damaging Het
Dennd5b T C 6: 148,946,253 (GRCm39) T453A probably benign Het
Dlgap3 A G 4: 127,089,193 (GRCm39) D263G probably damaging Het
Dnah3 TTCCTC TTC 7: 119,550,244 (GRCm39) probably benign Het
Dync2li1 G A 17: 84,940,990 (GRCm39) G69R probably damaging Het
Edc3 T C 9: 57,651,885 (GRCm39) V331A probably benign Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Ganc C T 2: 120,242,020 (GRCm39) T66I possibly damaging Het
Gm11595 C A 11: 99,663,143 (GRCm39) C179F unknown Het
Gnptg A G 17: 25,454,391 (GRCm39) S159P probably damaging Het
Gsdmc2 C T 15: 63,698,059 (GRCm39) V349I probably benign Het
Hydin T C 8: 111,259,846 (GRCm39) I2606T possibly damaging Het
Ino80d A G 1: 63,097,999 (GRCm39) S632P probably damaging Het
Kcnn2 G A 18: 45,692,463 (GRCm39) R13H probably benign Het
Klb A T 5: 65,536,667 (GRCm39) K666* probably null Het
Kmt2d G A 15: 98,749,990 (GRCm39) probably benign Het
Kpna7 T C 5: 144,930,766 (GRCm39) I360V possibly damaging Het
Lmbrd2 A G 15: 9,182,657 (GRCm39) K576E possibly damaging Het
Lrp2 T A 2: 69,310,497 (GRCm39) Y2692F probably benign Het
Meis2 T A 2: 115,889,145 (GRCm39) E202D probably benign Het
Mgat4c A T 10: 102,224,826 (GRCm39) T347S probably damaging Het
Mmp12 G A 9: 7,347,501 (GRCm39) C26Y possibly damaging Het
Mrpl24 G A 3: 87,830,292 (GRCm39) R145Q probably damaging Het
Mtpn C T 6: 35,489,225 (GRCm39) D100N probably benign Het
Mycbpap T A 11: 94,396,436 (GRCm39) R135W probably damaging Het
Myo1g T A 11: 6,457,000 (GRCm39) Y942F probably benign Het
Myrf T C 19: 10,200,911 (GRCm39) K52R probably null Het
Ncf2 A T 1: 152,697,269 (GRCm39) silent Het
Nherf2 A T 17: 24,863,851 (GRCm39) M8K probably benign Het
Or51f1e T C 7: 102,747,161 (GRCm39) F71S probably damaging Het
Otx1 T C 11: 21,948,594 (GRCm39) probably benign Het
Pcnx1 T A 12: 81,965,429 (GRCm39) V532D possibly damaging Het
Pik3r5 T C 11: 68,383,096 (GRCm39) L305P probably damaging Het
Pira13 T A 7: 3,825,898 (GRCm39) R324* probably null Het
Polr3a A T 14: 24,500,766 (GRCm39) C1341S probably benign Het
Ppp1r3a T C 6: 14,718,983 (GRCm39) T644A probably benign Het
Pramel22 A G 4: 143,382,109 (GRCm39) S196P possibly damaging Het
Ptbp1 A G 10: 79,695,766 (GRCm39) D289G probably benign Het
Pwp2 A G 10: 78,007,952 (GRCm39) F868L probably benign Het
Rgs8 A G 1: 153,568,574 (GRCm39) E153G probably damaging Het
Rhbdf2 G A 11: 116,493,180 (GRCm39) probably benign Het
Sbf1 T C 15: 89,192,271 (GRCm39) H78R probably damaging Het
Sdr16c6 C T 4: 4,062,728 (GRCm39) A197T possibly damaging Het
Slc36a3 A T 11: 55,016,547 (GRCm39) Y349* probably null Het
Slc38a9 T C 13: 112,831,856 (GRCm39) L202P possibly damaging Het
Slc40a1 A T 1: 45,951,509 (GRCm39) M216K probably damaging Het
Srebf1 T A 11: 60,094,410 (GRCm39) Q568H possibly damaging Het
Srp54b A G 12: 55,299,614 (GRCm39) N315S probably benign Het
Strc A G 2: 121,196,358 (GRCm39) F1557L probably benign Het
Susd3 C A 13: 49,392,202 (GRCm39) probably benign Het
Usp54 G A 14: 20,600,351 (GRCm39) T1462I probably benign Het
Vmn1r11 T A 6: 57,114,787 (GRCm39) N150K probably damaging Het
Vwa8 C T 14: 79,231,958 (GRCm39) H606Y probably benign Het
Zmym6 A G 4: 126,994,463 (GRCm39) I206V possibly damaging Het
Other mutations in Abcb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02836:Abcb6 APN 1 75,154,646 (GRCm39) missense probably damaging 0.96
1mM(1):Abcb6 UTSW 1 75,148,755 (GRCm39) unclassified probably benign
R0035:Abcb6 UTSW 1 75,151,651 (GRCm39) missense possibly damaging 0.74
R0699:Abcb6 UTSW 1 75,148,553 (GRCm39) missense probably damaging 0.98
R1470:Abcb6 UTSW 1 75,149,323 (GRCm39) unclassified probably benign
R1595:Abcb6 UTSW 1 75,153,944 (GRCm39) splice site probably null
R1912:Abcb6 UTSW 1 75,156,599 (GRCm39) missense probably benign
R2078:Abcb6 UTSW 1 75,148,780 (GRCm39) missense probably damaging 1.00
R3105:Abcb6 UTSW 1 75,151,687 (GRCm39) unclassified probably benign
R4015:Abcb6 UTSW 1 75,151,135 (GRCm39) splice site probably null
R4604:Abcb6 UTSW 1 75,156,521 (GRCm39) missense probably benign
R4633:Abcb6 UTSW 1 75,154,426 (GRCm39) unclassified probably benign
R4748:Abcb6 UTSW 1 75,154,002 (GRCm39) missense probably damaging 1.00
R5530:Abcb6 UTSW 1 75,154,556 (GRCm39) unclassified probably benign
R5654:Abcb6 UTSW 1 75,151,479 (GRCm39) splice site probably null
R6275:Abcb6 UTSW 1 75,149,195 (GRCm39) splice site probably null
R6527:Abcb6 UTSW 1 75,154,132 (GRCm39) critical splice acceptor site probably null
R7188:Abcb6 UTSW 1 75,150,781 (GRCm39) critical splice donor site probably null
R7278:Abcb6 UTSW 1 75,151,017 (GRCm39) missense possibly damaging 0.88
R7451:Abcb6 UTSW 1 75,148,797 (GRCm39) missense probably damaging 1.00
R7481:Abcb6 UTSW 1 75,150,248 (GRCm39) missense probably damaging 1.00
R7608:Abcb6 UTSW 1 75,154,347 (GRCm39) missense probably benign 0.01
R7640:Abcb6 UTSW 1 75,151,489 (GRCm39) splice site probably null
R7883:Abcb6 UTSW 1 75,154,660 (GRCm39) missense possibly damaging 0.81
R7982:Abcb6 UTSW 1 75,150,284 (GRCm39) missense probably damaging 1.00
R8057:Abcb6 UTSW 1 75,151,002 (GRCm39) missense probably damaging 0.99
R8058:Abcb6 UTSW 1 75,156,653 (GRCm39) missense possibly damaging 0.79
R8155:Abcb6 UTSW 1 75,151,413 (GRCm39) missense probably damaging 0.99
R8309:Abcb6 UTSW 1 75,149,588 (GRCm39) missense probably benign 0.43
R9087:Abcb6 UTSW 1 75,150,211 (GRCm39) missense probably damaging 1.00
R9599:Abcb6 UTSW 1 75,151,372 (GRCm39) missense possibly damaging 0.63
R9723:Abcb6 UTSW 1 75,156,366 (GRCm39) missense probably benign
X0009:Abcb6 UTSW 1 75,151,197 (GRCm39) missense probably benign 0.35
Z1177:Abcb6 UTSW 1 75,152,769 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATGAAAACGAAGGGGCCC -3'
(R):5'- GTGACATACTTGCTTCTCTGGG -3'

Sequencing Primer
(F):5'- AACGAAGGGGCCCTGCAC -3'
(R):5'- TTGGCACTTACATCACCCAACTG -3'
Posted On 2016-12-20