Incidental Mutation 'R5841:Meis2'
ID450418
Institutional Source Beutler Lab
Gene Symbol Meis2
Ensembl Gene ENSMUSG00000027210
Gene NameMeis homeobox 2
SynonymsStra10, Meis2, A430109D20Rik, Mrg1
MMRRC Submission 044061-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.884) question?
Stock #R5841 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location115863064-116065839 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116058664 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 202 (E202D)
Ref Sequence ENSEMBL: ENSMUSP00000106533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028639] [ENSMUST00000074285] [ENSMUST00000102538] [ENSMUST00000110906] [ENSMUST00000110907] [ENSMUST00000110908]
Predicted Effect probably benign
Transcript: ENSMUST00000028639
AA Change: E202D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028639
Gene: ENSMUSG00000027210
AA Change: E202D

DomainStartEndE-ValueType
Pfam:Meis_PKNOX_N 110 194 3.8e-48 PFAM
HOX 276 341 4.27e-12 SMART
low complexity region 395 402 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074285
AA Change: E201D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073898
Gene: ENSMUSG00000027210
AA Change: E201D

DomainStartEndE-ValueType
HOX 275 340 4.27e-12 SMART
low complexity region 375 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102538
AA Change: E202D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099597
Gene: ENSMUSG00000027210
AA Change: E202D

DomainStartEndE-ValueType
HOX 276 341 4.27e-12 SMART
low complexity region 388 395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110906
AA Change: E201D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106531
Gene: ENSMUSG00000027210
AA Change: E201D

DomainStartEndE-ValueType
HOX 275 340 4.27e-12 SMART
low complexity region 382 395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110907
AA Change: E202D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106532
Gene: ENSMUSG00000027210
AA Change: E202D

DomainStartEndE-ValueType
HOX 276 341 4.27e-12 SMART
low complexity region 383 396 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110908
AA Change: E202D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106533
Gene: ENSMUSG00000027210
AA Change: E202D

DomainStartEndE-ValueType
HOX 276 341 4.27e-12 SMART
low complexity region 376 389 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133990
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134314
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138526
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140461
Meta Mutation Damage Score 0.0578 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: This gene encodes a homeobox protein belonging to the TALE ('three amino acid loop extension') family of homeodomain-containing proteins. TALE homeobox proteins are highly conserved transcriptional regulators and several members have been shown to be essential contributors to developmental programs. In mice, a knock-out of this gene leads to lethality at embryonic day 14, accompanied with hemorrhaging. Embryos lacking this gene show defects in tissues derived from the neural crest, suggesting a critical role of this gene during cranial and cardiac neural crest cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele display early fetal lethality with hemorrhaging, persistent truncus arteriosis, absence of cardic valves and defects in other neural crest cell derived tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A T 1: 75,174,350 F565L possibly damaging Het
Abhd6 T A 14: 8,049,596 V188D probably benign Het
Bbs12 T G 3: 37,319,521 N39K probably benign Het
Bend5 A G 4: 111,433,470 Y221C probably damaging Het
Brd8 A G 18: 34,605,523 S683P probably damaging Het
Caskin1 A G 17: 24,496,209 D79G probably damaging Het
Cdyl T C 13: 35,872,561 L509P probably damaging Het
Cenpf G T 1: 189,657,444 T1397N possibly damaging Het
Ckap5 T A 2: 91,600,682 M1479K probably benign Het
Cpsf2 T C 12: 101,985,238 S145P probably damaging Het
Cyp4a12a A T 4: 115,326,702 H235L probably benign Het
Cyp7b1 A T 3: 18,097,506 F181Y probably damaging Het
Dennd5b T C 6: 149,044,755 T453A probably benign Het
Dlgap3 A G 4: 127,195,400 D263G probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Dync2li1 G A 17: 84,633,562 G69R probably damaging Het
Edc3 T C 9: 57,744,602 V331A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ganc C T 2: 120,411,539 T66I possibly damaging Het
Gm11595 C A 11: 99,772,317 C179F unknown Het
Gm13088 A G 4: 143,655,539 S196P possibly damaging Het
Gm15448 T A 7: 3,822,899 R324* probably null Het
Gnptg A G 17: 25,235,417 S159P probably damaging Het
Gsdmc2 C T 15: 63,826,210 V349I probably benign Het
Hydin T C 8: 110,533,214 I2606T possibly damaging Het
Ino80d A G 1: 63,058,840 S632P probably damaging Het
Kcnn2 G A 18: 45,559,396 R13H probably benign Het
Klb A T 5: 65,379,324 K666* probably null Het
Kmt2d G A 15: 98,852,109 probably benign Het
Kpna7 T C 5: 144,993,956 I360V possibly damaging Het
Lmbrd2 A G 15: 9,182,570 K576E possibly damaging Het
Lrp2 T A 2: 69,480,153 Y2692F probably benign Het
Mgat4c A T 10: 102,388,965 T347S probably damaging Het
Mmp12 G A 9: 7,347,501 C26Y possibly damaging Het
Mrpl24 G A 3: 87,922,985 R145Q probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Mycbpap T A 11: 94,505,610 R135W probably damaging Het
Myo1g T A 11: 6,507,000 Y942F probably benign Het
Myrf T C 19: 10,223,547 K52R probably null Het
Ncf2 A T 1: 152,821,518 silent Het
Olfr585 T C 7: 103,097,954 F71S probably damaging Het
Otx1 T C 11: 21,998,594 probably benign Het
Pcnx T A 12: 81,918,655 V532D possibly damaging Het
Pik3r5 T C 11: 68,492,270 L305P probably damaging Het
Polr3a A T 14: 24,450,698 C1341S probably benign Het
Ppp1r3a T C 6: 14,718,984 T644A probably benign Het
Ptbp1 A G 10: 79,859,932 D289G probably benign Het
Pwp2 A G 10: 78,172,118 F868L probably benign Het
Rgs8 A G 1: 153,692,828 E153G probably damaging Het
Rhbdf2 G A 11: 116,602,354 probably benign Het
Sbf1 T C 15: 89,308,068 H78R probably damaging Het
Sdr16c6 C T 4: 4,062,728 A197T possibly damaging Het
Slc36a3 A T 11: 55,125,721 Y349* probably null Het
Slc38a9 T C 13: 112,695,322 L202P possibly damaging Het
Slc40a1 A T 1: 45,912,349 M216K probably damaging Het
Slc9a3r2 A T 17: 24,644,877 M8K probably benign Het
Srebf1 T A 11: 60,203,584 Q568H possibly damaging Het
Srp54b A G 12: 55,252,829 N315S probably benign Het
Strc A G 2: 121,365,877 F1557L probably benign Het
Susd3 C A 13: 49,238,726 probably benign Het
Usp54 G A 14: 20,550,283 T1462I probably benign Het
Vmn1r11 T A 6: 57,137,802 N150K probably damaging Het
Vwa8 C T 14: 78,994,518 H606Y probably benign Het
Zmym6 A G 4: 127,100,670 I206V possibly damaging Het
Other mutations in Meis2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Meis2 APN 2 115868793 missense probably damaging 1.00
IGL00708:Meis2 APN 2 115864244 missense probably benign 0.11
IGL01095:Meis2 APN 2 115864424 missense probably benign
IGL02199:Meis2 APN 2 116000256 missense probably benign 0.01
IGL02562:Meis2 APN 2 116049146 missense probably damaging 1.00
IGL02902:Meis2 APN 2 116063323 missense probably damaging 0.96
IGL03183:Meis2 APN 2 116059521 missense probably damaging 0.98
IGL03205:Meis2 APN 2 115864250 missense probably benign 0.08
P4748:Meis2 UTSW 2 115864480 missense probably benign 0.03
R0369:Meis2 UTSW 2 116063416 missense possibly damaging 0.82
R0410:Meis2 UTSW 2 115864228 makesense probably null
R1465:Meis2 UTSW 2 116058670 missense probably benign 0.03
R1465:Meis2 UTSW 2 116058670 missense probably benign 0.03
R1548:Meis2 UTSW 2 116058702 missense probably damaging 0.97
R1593:Meis2 UTSW 2 116000264 missense probably damaging 1.00
R3835:Meis2 UTSW 2 115921747 missense probably damaging 1.00
R4353:Meis2 UTSW 2 116059563 missense probably damaging 0.99
R4756:Meis2 UTSW 2 116000205 missense probably damaging 1.00
R4936:Meis2 UTSW 2 115864412 missense probably benign
R5967:Meis2 UTSW 2 115864309 missense probably benign 0.04
R6661:Meis2 UTSW 2 115864270 missense probably damaging 0.97
R6781:Meis2 UTSW 2 116049155 missense probably benign 0.20
R7239:Meis2 UTSW 2 116059003 splice site probably null
R7606:Meis2 UTSW 2 116063320 missense possibly damaging 0.93
R7919:Meis2 UTSW 2 115867307 missense probably benign 0.01
R8134:Meis2 UTSW 2 115866888 missense probably benign 0.22
R8797:Meis2 UTSW 2 115864505 missense probably benign
R8881:Meis2 UTSW 2 116058635 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ATCAACTCCCTGGTTCTTAGAC -3'
(R):5'- ACAAATGTAACCTTGCAACCTG -3'

Sequencing Primer
(F):5'- TCTCACCATAAATAAGAACAGGGTC -3'
(R):5'- ATGTAACCTTGCAACCTGATATTC -3'
Posted On2016-12-20