Incidental Mutation 'R5841:Ganc'
ID450419
Institutional Source Beutler Lab
Gene Symbol Ganc
Ensembl Gene ENSMUSG00000062646
Gene Nameglucosidase, alpha; neutral C
Synonyms5830445O15Rik
MMRRC Submission 044061-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.580) question?
Stock #R5841 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location120403896-120461700 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120411539 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 66 (T66I)
Ref Sequence ENSEMBL: ENSMUSP00000116898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000135074]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000043755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132835
Predicted Effect possibly damaging
Transcript: ENSMUST00000135074
AA Change: T66I

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116898
Gene: ENSMUSG00000062646
AA Change: T66I

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
Pfam:Gal_mutarotas_2 221 292 2.3e-21 PFAM
Pfam:Glyco_hydro_31 333 778 2.5e-137 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154574
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154963
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glycosyl hydrolase enzymes hydrolyse the glycosidic bond between two or more carbohydrates, or between a carbohydrate and a non-carbohydrate moiety. This gene encodes a member of glycosyl hydrolases family 31. This enzyme hydrolyses terminal, non-reducing 1,4-linked alpha-D-glucose residues and releases alpha-D-glucose. This is a key enzyme in glycogen metabolism and its gene localizes to a chromosomal region (15q15) that is associated with susceptibility to diabetes. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A T 1: 75,174,350 F565L possibly damaging Het
Abhd6 T A 14: 8,049,596 V188D probably benign Het
Bbs12 T G 3: 37,319,521 N39K probably benign Het
Bend5 A G 4: 111,433,470 Y221C probably damaging Het
Brd8 A G 18: 34,605,523 S683P probably damaging Het
Caskin1 A G 17: 24,496,209 D79G probably damaging Het
Cdyl T C 13: 35,872,561 L509P probably damaging Het
Cenpf G T 1: 189,657,444 T1397N possibly damaging Het
Ckap5 T A 2: 91,600,682 M1479K probably benign Het
Cpsf2 T C 12: 101,985,238 S145P probably damaging Het
Cyp4a12a A T 4: 115,326,702 H235L probably benign Het
Cyp7b1 A T 3: 18,097,506 F181Y probably damaging Het
Dennd5b T C 6: 149,044,755 T453A probably benign Het
Dlgap3 A G 4: 127,195,400 D263G probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Dync2li1 G A 17: 84,633,562 G69R probably damaging Het
Edc3 T C 9: 57,744,602 V331A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Gm11595 C A 11: 99,772,317 C179F unknown Het
Gm13088 A G 4: 143,655,539 S196P possibly damaging Het
Gm15448 T A 7: 3,822,899 R324* probably null Het
Gnptg A G 17: 25,235,417 S159P probably damaging Het
Gsdmc2 C T 15: 63,826,210 V349I probably benign Het
Hydin T C 8: 110,533,214 I2606T possibly damaging Het
Ino80d A G 1: 63,058,840 S632P probably damaging Het
Kcnn2 G A 18: 45,559,396 R13H probably benign Het
Klb A T 5: 65,379,324 K666* probably null Het
Kmt2d G A 15: 98,852,109 probably benign Het
Kpna7 T C 5: 144,993,956 I360V possibly damaging Het
Lmbrd2 A G 15: 9,182,570 K576E possibly damaging Het
Lrp2 T A 2: 69,480,153 Y2692F probably benign Het
Meis2 T A 2: 116,058,664 E202D probably benign Het
Mgat4c A T 10: 102,388,965 T347S probably damaging Het
Mmp12 G A 9: 7,347,501 C26Y possibly damaging Het
Mrpl24 G A 3: 87,922,985 R145Q probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Mycbpap T A 11: 94,505,610 R135W probably damaging Het
Myo1g T A 11: 6,507,000 Y942F probably benign Het
Myrf T C 19: 10,223,547 K52R probably null Het
Ncf2 A T 1: 152,821,518 silent Het
Olfr585 T C 7: 103,097,954 F71S probably damaging Het
Otx1 T C 11: 21,998,594 probably benign Het
Pcnx T A 12: 81,918,655 V532D possibly damaging Het
Pik3r5 T C 11: 68,492,270 L305P probably damaging Het
Polr3a A T 14: 24,450,698 C1341S probably benign Het
Ppp1r3a T C 6: 14,718,984 T644A probably benign Het
Ptbp1 A G 10: 79,859,932 D289G probably benign Het
Pwp2 A G 10: 78,172,118 F868L probably benign Het
Rgs8 A G 1: 153,692,828 E153G probably damaging Het
Rhbdf2 G A 11: 116,602,354 probably benign Het
Sbf1 T C 15: 89,308,068 H78R probably damaging Het
Sdr16c6 C T 4: 4,062,728 A197T possibly damaging Het
Slc36a3 A T 11: 55,125,721 Y349* probably null Het
Slc38a9 T C 13: 112,695,322 L202P possibly damaging Het
Slc40a1 A T 1: 45,912,349 M216K probably damaging Het
Slc9a3r2 A T 17: 24,644,877 M8K probably benign Het
Srebf1 T A 11: 60,203,584 Q568H possibly damaging Het
Srp54b A G 12: 55,252,829 N315S probably benign Het
Strc A G 2: 121,365,877 F1557L probably benign Het
Susd3 C A 13: 49,238,726 probably benign Het
Usp54 G A 14: 20,550,283 T1462I probably benign Het
Vmn1r11 T A 6: 57,137,802 N150K probably damaging Het
Vwa8 C T 14: 78,994,518 H606Y probably benign Het
Zmym6 A G 4: 127,100,670 I206V possibly damaging Het
Other mutations in Ganc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Ganc APN 2 120441598 missense probably damaging 1.00
IGL00913:Ganc APN 2 120439452 splice site probably benign
IGL01077:Ganc APN 2 120446515 missense possibly damaging 0.50
IGL01773:Ganc APN 2 120459884 missense possibly damaging 0.87
IGL01812:Ganc APN 2 120411526 missense probably benign 0.00
IGL02029:Ganc APN 2 120459857 missense probably benign 0.00
IGL02067:Ganc APN 2 120406304 missense probably benign 0.16
IGL02290:Ganc APN 2 120448423 missense possibly damaging 0.90
IGL02355:Ganc APN 2 120433757 missense probably damaging 1.00
IGL02362:Ganc APN 2 120433757 missense probably damaging 1.00
IGL02553:Ganc APN 2 120458134 missense probably benign
IGL02808:Ganc APN 2 120411511 missense probably benign 0.00
IGL02966:Ganc APN 2 120433648 missense probably damaging 1.00
IGL03356:Ganc APN 2 120435288 missense probably benign 0.22
IGL03405:Ganc APN 2 120433766 missense probably damaging 1.00
ingenuous UTSW 2 120444149 missense probably damaging 1.00
R0464:Ganc UTSW 2 120436694 missense probably benign 0.07
R0511:Ganc UTSW 2 120448401 nonsense probably null
R0932:Ganc UTSW 2 120458129 missense probably damaging 0.99
R1467:Ganc UTSW 2 120430928 splice site probably benign
R1902:Ganc UTSW 2 120446482 missense probably damaging 1.00
R2087:Ganc UTSW 2 120457257 missense probably damaging 1.00
R4668:Ganc UTSW 2 120431067 missense probably benign 0.02
R4669:Ganc UTSW 2 120431067 missense probably benign 0.02
R4725:Ganc UTSW 2 120435273 missense probably damaging 0.99
R4735:Ganc UTSW 2 120436623 splice site silent
R4738:Ganc UTSW 2 120452594 missense probably damaging 0.97
R4839:Ganc UTSW 2 120459823 missense probably benign
R4951:Ganc UTSW 2 120456047 missense probably benign 0.00
R5997:Ganc UTSW 2 120430605 missense possibly damaging 0.55
R6142:Ganc UTSW 2 120430737 critical splice donor site probably null
R6378:Ganc UTSW 2 120433826 missense probably damaging 1.00
R6711:Ganc UTSW 2 120450839 missense possibly damaging 0.74
R6777:Ganc UTSW 2 120444149 missense probably damaging 1.00
R7229:Ganc UTSW 2 120427775 missense possibly damaging 0.92
R7235:Ganc UTSW 2 120433717 missense probably damaging 1.00
R7241:Ganc UTSW 2 120441529 missense probably damaging 1.00
R7326:Ganc UTSW 2 120430599 missense probably damaging 1.00
R7567:Ganc UTSW 2 120456101 missense probably benign 0.01
R7685:Ganc UTSW 2 120433792 missense probably damaging 1.00
R7736:Ganc UTSW 2 120433814 missense possibly damaging 0.83
R7784:Ganc UTSW 2 120436668 nonsense probably null
R7955:Ganc UTSW 2 120430700 missense probably damaging 1.00
R8222:Ganc UTSW 2 120446452 missense probably damaging 1.00
R8247:Ganc UTSW 2 120436700 missense probably null 0.52
R8306:Ganc UTSW 2 120422079 missense probably benign 0.02
X0027:Ganc UTSW 2 120448450 missense probably damaging 1.00
Z1177:Ganc UTSW 2 120433794 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGATAGTCACAAGTAGTTCTC -3'
(R):5'- AGCTCAGTCACATGTAACCC -3'

Sequencing Primer
(F):5'- CCCTTACAGGCCAGTGATGAAG -3'
(R):5'- CCCCTCAAAAATGAATGAATGAATG -3'
Posted On2016-12-20