Incidental Mutation 'R5841:Cyp7b1'
ID450421
Institutional Source Beutler Lab
Gene Symbol Cyp7b1
Ensembl Gene ENSMUSG00000039519
Gene Namecytochrome P450, family 7, subfamily b, polypeptide 1
SynonymsD3Ertd552e, hct-1
MMRRC Submission 044061-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5841 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location18071950-18243338 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18097506 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 181 (F181Y)
Ref Sequence ENSEMBL: ENSMUSP00000037487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035625]
Predicted Effect probably damaging
Transcript: ENSMUST00000035625
AA Change: F181Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037487
Gene: ENSMUSG00000039519
AA Change: F181Y

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
Pfam:p450 44 496 1e-52 PFAM
Meta Mutation Damage Score 0.2591 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum membrane protein catalyzes the first reaction in the cholesterol catabolic pathway of extrahepatic tissues, which converts cholesterol to bile acids. This enzyme likely plays a minor role in total bile acid synthesis, but may also be involved in the development of atherosclerosis, neurosteroid metabolism and sex hormone synthesis. Mutations in this gene have been associated with hereditary spastic paraplegia (SPG5 or HSP), an autosomal recessive disorder. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele show significantly increased levels of 25- and 27-hydroxycholesterol, and reduced IgA levels. Female mice homozygous for a reporter allele display early onset of puberty and early ovarian failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A T 1: 75,174,350 F565L possibly damaging Het
Abhd6 T A 14: 8,049,596 V188D probably benign Het
Bbs12 T G 3: 37,319,521 N39K probably benign Het
Bend5 A G 4: 111,433,470 Y221C probably damaging Het
Brd8 A G 18: 34,605,523 S683P probably damaging Het
Caskin1 A G 17: 24,496,209 D79G probably damaging Het
Cdyl T C 13: 35,872,561 L509P probably damaging Het
Cenpf G T 1: 189,657,444 T1397N possibly damaging Het
Ckap5 T A 2: 91,600,682 M1479K probably benign Het
Cpsf2 T C 12: 101,985,238 S145P probably damaging Het
Cyp4a12a A T 4: 115,326,702 H235L probably benign Het
Dennd5b T C 6: 149,044,755 T453A probably benign Het
Dlgap3 A G 4: 127,195,400 D263G probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Dync2li1 G A 17: 84,633,562 G69R probably damaging Het
Edc3 T C 9: 57,744,602 V331A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ganc C T 2: 120,411,539 T66I possibly damaging Het
Gm11595 C A 11: 99,772,317 C179F unknown Het
Gm13088 A G 4: 143,655,539 S196P possibly damaging Het
Gm15448 T A 7: 3,822,899 R324* probably null Het
Gnptg A G 17: 25,235,417 S159P probably damaging Het
Gsdmc2 C T 15: 63,826,210 V349I probably benign Het
Hydin T C 8: 110,533,214 I2606T possibly damaging Het
Ino80d A G 1: 63,058,840 S632P probably damaging Het
Kcnn2 G A 18: 45,559,396 R13H probably benign Het
Klb A T 5: 65,379,324 K666* probably null Het
Kmt2d G A 15: 98,852,109 probably benign Het
Kpna7 T C 5: 144,993,956 I360V possibly damaging Het
Lmbrd2 A G 15: 9,182,570 K576E possibly damaging Het
Lrp2 T A 2: 69,480,153 Y2692F probably benign Het
Meis2 T A 2: 116,058,664 E202D probably benign Het
Mgat4c A T 10: 102,388,965 T347S probably damaging Het
Mmp12 G A 9: 7,347,501 C26Y possibly damaging Het
Mrpl24 G A 3: 87,922,985 R145Q probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Mycbpap T A 11: 94,505,610 R135W probably damaging Het
Myo1g T A 11: 6,507,000 Y942F probably benign Het
Myrf T C 19: 10,223,547 K52R probably null Het
Ncf2 A T 1: 152,821,518 silent Het
Olfr585 T C 7: 103,097,954 F71S probably damaging Het
Otx1 T C 11: 21,998,594 probably benign Het
Pcnx T A 12: 81,918,655 V532D possibly damaging Het
Pik3r5 T C 11: 68,492,270 L305P probably damaging Het
Polr3a A T 14: 24,450,698 C1341S probably benign Het
Ppp1r3a T C 6: 14,718,984 T644A probably benign Het
Ptbp1 A G 10: 79,859,932 D289G probably benign Het
Pwp2 A G 10: 78,172,118 F868L probably benign Het
Rgs8 A G 1: 153,692,828 E153G probably damaging Het
Rhbdf2 G A 11: 116,602,354 probably benign Het
Sbf1 T C 15: 89,308,068 H78R probably damaging Het
Sdr16c6 C T 4: 4,062,728 A197T possibly damaging Het
Slc36a3 A T 11: 55,125,721 Y349* probably null Het
Slc38a9 T C 13: 112,695,322 L202P possibly damaging Het
Slc40a1 A T 1: 45,912,349 M216K probably damaging Het
Slc9a3r2 A T 17: 24,644,877 M8K probably benign Het
Srebf1 T A 11: 60,203,584 Q568H possibly damaging Het
Srp54b A G 12: 55,252,829 N315S probably benign Het
Strc A G 2: 121,365,877 F1557L probably benign Het
Susd3 C A 13: 49,238,726 probably benign Het
Usp54 G A 14: 20,550,283 T1462I probably benign Het
Vmn1r11 T A 6: 57,137,802 N150K probably damaging Het
Vwa8 C T 14: 78,994,518 H606Y probably benign Het
Zmym6 A G 4: 127,100,670 I206V possibly damaging Het
Other mutations in Cyp7b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02728:Cyp7b1 APN 3 18072575 missense probably damaging 1.00
R0166:Cyp7b1 UTSW 3 18097366 missense probably benign 0.23
R0334:Cyp7b1 UTSW 3 18103796 missense probably damaging 1.00
R0417:Cyp7b1 UTSW 3 18096691 missense probably damaging 1.00
R0696:Cyp7b1 UTSW 3 18072585 missense probably benign 0.23
R0894:Cyp7b1 UTSW 3 18097510 missense probably benign 0.00
R1799:Cyp7b1 UTSW 3 18097452 missense probably benign 0.01
R1893:Cyp7b1 UTSW 3 18096567 missense possibly damaging 0.57
R4538:Cyp7b1 UTSW 3 18097581 missense possibly damaging 0.71
R4692:Cyp7b1 UTSW 3 18072564 missense probably damaging 0.97
R4877:Cyp7b1 UTSW 3 18097293 missense probably damaging 0.98
R5382:Cyp7b1 UTSW 3 18097221 missense possibly damaging 0.53
R6867:Cyp7b1 UTSW 3 18097230 missense probably damaging 1.00
R7007:Cyp7b1 UTSW 3 18097618 nonsense probably null
R7379:Cyp7b1 UTSW 3 18097374 missense probably benign 0.23
R7554:Cyp7b1 UTSW 3 18097446 missense probably benign 0.00
R7814:Cyp7b1 UTSW 3 18097302 missense probably benign 0.00
R8137:Cyp7b1 UTSW 3 18097601 missense probably benign 0.23
R8338:Cyp7b1 UTSW 3 18097566 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTCCTTGCATCTGAGCTAC -3'
(R):5'- AAGCTGCTTACTGATGACGACC -3'

Sequencing Primer
(F):5'- GCATCTGAGCTACTTTTTCTGATG -3'
(R):5'- GCTGCTTACTGATGACGACCTTAATG -3'
Posted On2016-12-20