Incidental Mutation 'R0549:Smpd4'
ID45043
Institutional Source Beutler Lab
Gene Symbol Smpd4
Ensembl Gene ENSMUSG00000005899
Gene Namesphingomyelin phosphodiesterase 4
Synonyms4122402O22Rik, neutral membrane (neutral sphingomyelinase-3)
MMRRC Submission 038741-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R0549 (G1)
Quality Score107
Status Validated
Chromosome16
Chromosomal Location17619354-17644828 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17639312 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 378 (V378A)
Ref Sequence ENSEMBL: ENSMUSP00000006053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006053] [ENSMUST00000090159] [ENSMUST00000163476] [ENSMUST00000163997] [ENSMUST00000165363] [ENSMUST00000170273] [ENSMUST00000170366] [ENSMUST00000170996] [ENSMUST00000231792] [ENSMUST00000232021] [ENSMUST00000232271] [ENSMUST00000231436] [ENSMUST00000231627] [ENSMUST00000232116] [ENSMUST00000231722]
Predicted Effect probably benign
Transcript: ENSMUST00000006053
AA Change: V378A

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000006053
Gene: ENSMUSG00000005899
AA Change: V378A

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 768 N/A PFAM
transmembrane domain 769 791 N/A INTRINSIC
transmembrane domain 798 815 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090159
AA Change: V349A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000087620
Gene: ENSMUSG00000005899
AA Change: V349A

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 288 7.4e-177 PFAM
Pfam:mit_SMPDase 287 752 9.4e-259 PFAM
transmembrane domain 753 775 N/A INTRINSIC
transmembrane domain 782 799 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163476
AA Change: V349A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000131867
Gene: ENSMUSG00000005899
AA Change: V349A

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 289 6.2e-177 PFAM
Pfam:mit_SMPDase 285 739 9.8e-266 PFAM
transmembrane domain 740 762 N/A INTRINSIC
transmembrane domain 769 786 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163997
AA Change: V128A

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000128595
Gene: ENSMUSG00000005899
AA Change: V128A

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 43 2.1e-17 PFAM
Pfam:mit_SMPDase 42 68 2.5e-13 PFAM
Pfam:mit_SMPDase 65 518 4.9e-266 PFAM
transmembrane domain 519 541 N/A INTRINSIC
transmembrane domain 548 565 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164292
Predicted Effect probably benign
Transcript: ENSMUST00000165363
AA Change: V349A

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000130720
Gene: ENSMUSG00000005899
AA Change: V349A

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 289 6.2e-177 PFAM
Pfam:mit_SMPDase 285 738 4.1e-262 PFAM
transmembrane domain 739 761 N/A INTRINSIC
transmembrane domain 768 785 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166091
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167592
Predicted Effect probably benign
Transcript: ENSMUST00000170273
AA Change: V276A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000129957
Gene: ENSMUSG00000005899
AA Change: V276A

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 43 2.6e-17 PFAM
Pfam:mit_SMPDase 41 215 4.1e-103 PFAM
Pfam:mit_SMPDase 214 666 1.3e-265 PFAM
transmembrane domain 667 689 N/A INTRINSIC
transmembrane domain 696 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170366
AA Change: V349A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000130990
Gene: ENSMUSG00000005899
AA Change: V349A

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 288 7.1e-177 PFAM
Pfam:mit_SMPDase 286 643 1.8e-214 PFAM
Pfam:mit_SMPDase 642 696 8.6e-18 PFAM
transmembrane domain 697 719 N/A INTRINSIC
transmembrane domain 726 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170996
AA Change: V54A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000129074
Gene: ENSMUSG00000005899
AA Change: V54A

DomainStartEndE-ValueType
Pfam:mit_SMPDase 26 444 4.4e-234 PFAM
transmembrane domain 445 467 N/A INTRINSIC
transmembrane domain 474 491 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170401
Predicted Effect probably benign
Transcript: ENSMUST00000231792
AA Change: V128A

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000232021
AA Change: V276A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000232271
AA Change: V54A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000231436
AA Change: V349A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000231627
Predicted Effect probably benign
Transcript: ENSMUST00000232116
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231378
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232185
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232270
Predicted Effect probably benign
Transcript: ENSMUST00000231722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232468
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sphingomyelinases (EC 3.1.4.12), such as SMPD4, catalyze the hydrolysis of membrane sphingomyelin to form phosphorylcholine and ceramide (Krut et al., 2006 [PubMed 16517606]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A G 17: 46,322,290 F498L probably damaging Het
Adamts6 A T 13: 104,297,255 D64V possibly damaging Het
Agbl2 T C 2: 90,789,843 probably benign Het
Angptl3 A G 4: 99,031,455 S151G probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
C4b G T 17: 34,735,415 L927I probably damaging Het
Ccl3 T C 11: 83,648,336 T66A probably damaging Het
Cdh7 T C 1: 110,108,944 L618P probably damaging Het
Cfap65 T C 1: 74,918,444 T989A probably benign Het
Cnpy4 T C 5: 138,187,637 F18S possibly damaging Het
Col6a5 A G 9: 105,904,579 probably benign Het
Dppa2 G A 16: 48,318,671 R289H probably benign Het
Evx2 T C 2: 74,659,134 T96A probably benign Het
Frmd4a A G 2: 4,603,967 E577G possibly damaging Het
Gcgr G A 11: 120,536,561 G166S probably benign Het
Gm4788 A T 1: 139,739,488 D377E probably damaging Het
Gm5316 T C 6: 122,900,191 noncoding transcript Het
Gria1 G A 11: 57,228,973 R292Q probably damaging Het
Hars2 T A 18: 36,786,208 probably null Het
Hkdc1 T A 10: 62,400,240 T508S probably benign Het
Kif2b A T 11: 91,576,584 I291N probably damaging Het
Lmbrd1 A T 1: 24,744,920 T377S probably benign Het
Lrrc28 A G 7: 67,628,342 probably benign Het
Mmp3 A T 9: 7,455,638 N463I probably benign Het
Myh6 A G 14: 54,958,608 F578S probably damaging Het
Ncbp1 T A 4: 46,168,476 M608K possibly damaging Het
Nf1 T C 11: 79,468,771 F1412L probably damaging Het
Nlrp5 T A 7: 23,441,802 W1083R probably damaging Het
Nrsn1 T C 13: 25,262,258 Y45C probably benign Het
Olfr401 T G 11: 74,121,475 M62R probably damaging Het
Osbpl7 G T 11: 97,067,542 R881L probably damaging Het
Papss1 A G 3: 131,619,213 E456G possibly damaging Het
Pbxip1 T A 3: 89,443,592 probably benign Het
Pcca A G 14: 122,638,377 probably benign Het
Pde1a T A 2: 79,865,070 N511I probably damaging Het
Prpf39 A T 12: 65,056,256 I435F probably benign Het
Rnf213 C T 11: 119,465,082 T4117M probably damaging Het
Sel1l2 A T 2: 140,265,882 M216K probably damaging Het
Sidt2 A G 9: 45,953,119 probably null Het
Sirt3 A T 7: 140,869,487 probably null Het
Svil T A 18: 5,064,566 S642T possibly damaging Het
Tcp10a A G 17: 7,326,551 K92E probably benign Het
Tmem144 T C 3: 79,822,744 D233G probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnik T C 3: 28,570,920 S335P possibly damaging Het
Ush2a T C 1: 188,946,953 L4786P probably damaging Het
Utp11 A T 4: 124,686,079 probably benign Het
Vmn1r67 A G 7: 10,447,714 N241D probably damaging Het
Vmn2r11 A T 5: 109,052,097 C497S possibly damaging Het
Other mutations in Smpd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Smpd4 APN 16 17642757 missense probably benign 0.04
IGL01461:Smpd4 APN 16 17621506 missense probably damaging 1.00
IGL02051:Smpd4 APN 16 17626518 missense probably damaging 1.00
IGL02492:Smpd4 APN 16 17639351 missense probably damaging 1.00
IGL03181:Smpd4 APN 16 17625807 nonsense probably null
Victim UTSW 16 17640971 missense probably damaging 1.00
weakling UTSW 16 17638486 intron probably benign
G1citation:Smpd4 UTSW 16 17640233 missense probably damaging 1.00
R0197:Smpd4 UTSW 16 17641597 critical splice donor site probably null
R0789:Smpd4 UTSW 16 17625826 missense probably benign 0.14
R1077:Smpd4 UTSW 16 17623969 missense probably damaging 1.00
R1120:Smpd4 UTSW 16 17638486 intron probably benign
R1716:Smpd4 UTSW 16 17642501 missense probably damaging 1.00
R1758:Smpd4 UTSW 16 17626008 missense probably damaging 0.99
R1758:Smpd4 UTSW 16 17640880 missense probably damaging 1.00
R1838:Smpd4 UTSW 16 17642302 splice site probably null
R2115:Smpd4 UTSW 16 17626865 missense probably benign 0.33
R2849:Smpd4 UTSW 16 17642212 missense probably damaging 1.00
R4654:Smpd4 UTSW 16 17642128 intron probably benign
R6157:Smpd4 UTSW 16 17641066 splice site probably null
R6190:Smpd4 UTSW 16 17632013 missense probably damaging 1.00
R6822:Smpd4 UTSW 16 17640233 missense probably damaging 1.00
R7062:Smpd4 UTSW 16 17640971 missense probably damaging 1.00
R7305:Smpd4 UTSW 16 17641783 missense probably damaging 0.99
R7759:Smpd4 UTSW 16 17638633 missense probably damaging 1.00
R7853:Smpd4 UTSW 16 17642741 missense probably damaging 1.00
R8187:Smpd4 UTSW 16 17629135 missense probably damaging 1.00
R8303:Smpd4 UTSW 16 17639331 missense probably damaging 1.00
R8518:Smpd4 UTSW 16 17641020 missense possibly damaging 0.89
R8735:Smpd4 UTSW 16 17635546 missense possibly damaging 0.92
Z1176:Smpd4 UTSW 16 17619586 intron probably benign
Z1177:Smpd4 UTSW 16 17621441 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- GCTGCCACTGACTTCAAAGGCAAC -3'
(R):5'- TCAGCGTAGATGCCAATGAGTGAAC -3'

Sequencing Primer
(F):5'- AGGCAACTTACACACTGTGTTC -3'
(R):5'- ATGAGTGAACAAGTCTTCCTCC -3'
Posted On2013-06-11