Incidental Mutation 'R5841:Klb'
ID450430
Institutional Source Beutler Lab
Gene Symbol Klb
Ensembl Gene ENSMUSG00000029195
Gene Nameklotho beta
SynonymsbetaKlotho
MMRRC Submission 044061-MU
Accession Numbers

Genbank: NM_031180.2; Ensembl: ENSMUST00000031096;

MGI:1932466

Is this an essential gene? Possibly non essential (E-score: 0.496) question?
Stock #R5841 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location65348314-65384007 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 65379324 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 666 (K666*)
Ref Sequence ENSEMBL: ENSMUSP00000031096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031096] [ENSMUST00000205084]
Predicted Effect probably null
Transcript: ENSMUST00000031096
AA Change: K666*
SMART Domains Protein: ENSMUSP00000031096
Gene: ENSMUSG00000029195
AA Change: K666*

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 77 385 8.8e-96 PFAM
Pfam:Glyco_hydro_1 374 506 1.7e-31 PFAM
Pfam:Glyco_hydro_1 515 965 6.3e-80 PFAM
transmembrane domain 995 1017 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205084
SMART Domains Protein: ENSMUSP00000145091
Gene: ENSMUSG00000029195

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 77 360 8.6e-94 PFAM
Meta Mutation Damage Score 0.6464 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (67/67)
MGI Phenotype Strain: 3587748
PHENOTYPE: Homozygous null mice display increased bile acid synthesis and excretion, resistance to gallstone formation, and slightly decreased body weight. Mice homozygous for a knock-out allele or a conditional allele activated in adipose tissue exhibit resistanceto FGF21-induced metabolic disruptions. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A T 1: 75,174,350 F565L possibly damaging Het
Abhd6 T A 14: 8,049,596 V188D probably benign Het
Bbs12 T G 3: 37,319,521 N39K probably benign Het
Bend5 A G 4: 111,433,470 Y221C probably damaging Het
Brd8 A G 18: 34,605,523 S683P probably damaging Het
Caskin1 A G 17: 24,496,209 D79G probably damaging Het
Cdyl T C 13: 35,872,561 L509P probably damaging Het
Cenpf G T 1: 189,657,444 T1397N possibly damaging Het
Ckap5 T A 2: 91,600,682 M1479K probably benign Het
Cpsf2 T C 12: 101,985,238 S145P probably damaging Het
Cyp4a12a A T 4: 115,326,702 H235L probably benign Het
Cyp7b1 A T 3: 18,097,506 F181Y probably damaging Het
Dennd5b T C 6: 149,044,755 T453A probably benign Het
Dlgap3 A G 4: 127,195,400 D263G probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Dync2li1 G A 17: 84,633,562 G69R probably damaging Het
Edc3 T C 9: 57,744,602 V331A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ganc C T 2: 120,411,539 T66I possibly damaging Het
Gm11595 C A 11: 99,772,317 C179F unknown Het
Gm13088 A G 4: 143,655,539 S196P possibly damaging Het
Gm15448 T A 7: 3,822,899 R324* probably null Het
Gnptg A G 17: 25,235,417 S159P probably damaging Het
Gsdmc2 C T 15: 63,826,210 V349I probably benign Het
Hydin T C 8: 110,533,214 I2606T possibly damaging Het
Ino80d A G 1: 63,058,840 S632P probably damaging Het
Kcnn2 G A 18: 45,559,396 R13H probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Kpna7 T C 5: 144,993,956 I360V possibly damaging Het
Lmbrd2 A G 15: 9,182,570 K576E possibly damaging Het
Lrp2 T A 2: 69,480,153 Y2692F probably benign Het
Meis2 T A 2: 116,058,664 E202D probably benign Het
Mgat4c A T 10: 102,388,965 T347S probably damaging Het
Mmp12 G A 9: 7,347,501 C26Y possibly damaging Het
Mrpl24 G A 3: 87,922,985 R145Q probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Mycbpap T A 11: 94,505,610 R135W probably damaging Het
Myo1g T A 11: 6,507,000 Y942F probably benign Het
Myrf T C 19: 10,223,547 K52R probably null Het
Ncf2 A T 1: 152,821,518 silent Het
Olfr585 T C 7: 103,097,954 F71S probably damaging Het
Otx1 T C 11: 21,998,594 probably benign Het
Pcnx T A 12: 81,918,655 V532D possibly damaging Het
Pik3r5 T C 11: 68,492,270 L305P probably damaging Het
Polr3a A T 14: 24,450,698 C1341S probably benign Het
Ppp1r3a T C 6: 14,718,984 T644A probably benign Het
Ptbp1 A G 10: 79,859,932 D289G probably benign Het
Pwp2 A G 10: 78,172,118 F868L probably benign Het
Rgs8 A G 1: 153,692,828 E153G probably damaging Het
Rhbdf2 G A 11: 116,602,354 probably benign Het
Sbf1 T C 15: 89,308,068 H78R probably damaging Het
Sdr16c6 C T 4: 4,062,728 A197T possibly damaging Het
Slc36a3 A T 11: 55,125,721 Y349* probably null Het
Slc38a9 T C 13: 112,695,322 L202P possibly damaging Het
Slc40a1 A T 1: 45,912,349 M216K probably damaging Het
Slc9a3r2 A T 17: 24,644,877 M8K probably benign Het
Srebf1 T A 11: 60,203,584 Q568H possibly damaging Het
Srp54b A G 12: 55,252,829 N315S probably benign Het
Strc A G 2: 121,365,877 F1557L probably benign Het
Susd3 C A 13: 49,238,726 probably benign Het
Usp54 G A 14: 20,550,283 T1462I probably benign Het
Vmn1r11 T A 6: 57,137,802 N150K probably damaging Het
Vwa8 C T 14: 78,994,518 H606Y probably benign Het
Zmym6 A G 4: 127,100,670 I206V possibly damaging Het
Other mutations in Klb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Klb APN 5 65372374 missense possibly damaging 0.90
IGL00821:Klb APN 5 65372149 missense probably damaging 1.00
IGL01082:Klb APN 5 65375940 missense possibly damaging 0.71
IGL01637:Klb APN 5 65375679 critical splice acceptor site probably null
IGL02098:Klb APN 5 65379885 missense probably benign 0.21
IGL03113:Klb APN 5 65383470 missense probably benign 0.00
1mM(1):Klb UTSW 5 65348650 missense probably damaging 1.00
P0016:Klb UTSW 5 65379923 nonsense probably null
R0268:Klb UTSW 5 65348837 missense probably benign 0.02
R0383:Klb UTSW 5 65372499 intron probably null
R0676:Klb UTSW 5 65379055 missense probably damaging 1.00
R0735:Klb UTSW 5 65379727 missense probably benign
R0972:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1051:Klb UTSW 5 65379327 missense probably damaging 1.00
R1168:Klb UTSW 5 65378974 missense probably damaging 1.00
R1372:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1403:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1403:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1446:Klb UTSW 5 65348995 missense probably damaging 1.00
R1696:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1743:Klb UTSW 5 65375861 missense probably damaging 0.99
R1801:Klb UTSW 5 65349235 missense probably null 0.90
R1804:Klb UTSW 5 65379853 missense probably damaging 1.00
R1848:Klb UTSW 5 65348837 missense probably benign 0.02
R1967:Klb UTSW 5 65372074 missense probably damaging 0.98
R3420:Klb UTSW 5 65372142 missense probably damaging 1.00
R4397:Klb UTSW 5 65380039 missense probably damaging 1.00
R4490:Klb UTSW 5 65375794 missense probably benign 0.02
R4491:Klb UTSW 5 65375794 missense probably benign 0.02
R4547:Klb UTSW 5 65379928 missense probably benign 0.00
R4878:Klb UTSW 5 65348490 missense probably damaging 0.99
R5269:Klb UTSW 5 65348797 missense probably damaging 1.00
R5418:Klb UTSW 5 65383470 missense probably benign 0.00
R5453:Klb UTSW 5 65383385 missense probably benign 0.08
R5541:Klb UTSW 5 65379234 missense probably benign 0.27
R5672:Klb UTSW 5 65379949 missense possibly damaging 0.82
R6088:Klb UTSW 5 65349013 missense probably benign 0.07
R6807:Klb UTSW 5 65379534 missense probably damaging 1.00
R6955:Klb UTSW 5 65379088 nonsense probably null
R7068:Klb UTSW 5 65379340 missense probably damaging 1.00
R7284:Klb UTSW 5 65383478 missense probably benign 0.01
R7322:Klb UTSW 5 65383364 missense probably benign 0.44
R7346:Klb UTSW 5 65348631 nonsense probably null
R7366:Klb UTSW 5 65372431 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTGCTCTGGACTGGACC -3'
(R):5'- CCTATACTGCCTATCATAGAGGTGC -3'

Sequencing Primer
(F):5'- TCCCACTGGCAATCTGTCCAAAG -3'
(R):5'- TGCCTATCATAGAGGTGCCAGAC -3'
Posted On2016-12-20