Incidental Mutation 'R5841:Kpna7'
ID450431
Institutional Source Beutler Lab
Gene Symbol Kpna7
Ensembl Gene ENSMUSG00000038770
Gene Namekaryopherin alpha 7 (importin alpha 8)
SynonymsLOC381686
MMRRC Submission 044061-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.405) question?
Stock #R5841 (G1)
Quality Score158
Status Validated
Chromosome5
Chromosomal Location144983519-145084030 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144993956 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 360 (I360V)
Ref Sequence ENSEMBL: ENSMUSP00000106301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110672] [ENSMUST00000110673] [ENSMUST00000116454]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110672
AA Change: I339V

PolyPhen 2 Score 0.496 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106300
Gene: ENSMUSG00000038770
AA Change: I339V

DomainStartEndE-ValueType
Pfam:IBB 2 91 1.7e-14 PFAM
ARM 100 141 1.4e-8 SMART
ARM 143 183 6.18e-10 SMART
ARM 185 226 1.78e-1 SMART
ARM 229 268 4.28e-4 SMART
ARM 270 310 1.19e-2 SMART
ARM 312 352 5.27e-4 SMART
ARM 354 393 2.85e0 SMART
ARM 396 436 8.17e-1 SMART
low complexity region 486 497 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110673
AA Change: I360V

PolyPhen 2 Score 0.727 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106301
Gene: ENSMUSG00000038770
AA Change: I360V

DomainStartEndE-ValueType
Pfam:IBB 6 90 2.7e-19 PFAM
ARM 100 141 1.4e-8 SMART
ARM 143 183 3.31e-10 SMART
ARM 206 247 1.78e-1 SMART
ARM 250 289 4.28e-4 SMART
ARM 291 331 1.19e-2 SMART
ARM 333 373 5.27e-4 SMART
ARM 375 414 2.85e0 SMART
ARM 417 457 8.17e-1 SMART
Pfam:Arm_3 466 517 8.9e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000116454
AA Change: I339V

PolyPhen 2 Score 0.496 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112155
Gene: ENSMUSG00000038770
AA Change: I339V

DomainStartEndE-ValueType
Pfam:IBB 2 91 1.7e-14 PFAM
ARM 100 141 1.4e-8 SMART
ARM 143 183 6.18e-10 SMART
ARM 185 226 1.78e-1 SMART
ARM 229 268 4.28e-4 SMART
ARM 270 310 1.19e-2 SMART
ARM 312 352 5.27e-4 SMART
ARM 354 393 2.85e0 SMART
ARM 396 436 8.17e-1 SMART
low complexity region 486 497 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142866
Meta Mutation Damage Score 0.3124 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transport of molecules between the nucleus and the cytoplasm in eukaryotic cells is mediated by the nuclear pore complex (NPC), which consists of 60-100 proteins. Small molecules (up to 70 kD) can pass through the nuclear pore by nonselective diffusion while larger molecules are transported by an active process. The protein encoded by this gene belongs to the importin alpha family, and is involved in nuclear protein import, but exhibits different nuclear localization signal binding specificity compared to other members of the family. A pseudogene of this gene has been defined on chromosome 5. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous or heterozygous for a null mutation display smaller litter sizes with preferential loss of females and accelerated cell cycles post fertilization resulting in loss of embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A T 1: 75,174,350 F565L possibly damaging Het
Abhd6 T A 14: 8,049,596 V188D probably benign Het
Bbs12 T G 3: 37,319,521 N39K probably benign Het
Bend5 A G 4: 111,433,470 Y221C probably damaging Het
Brd8 A G 18: 34,605,523 S683P probably damaging Het
Caskin1 A G 17: 24,496,209 D79G probably damaging Het
Cdyl T C 13: 35,872,561 L509P probably damaging Het
Cenpf G T 1: 189,657,444 T1397N possibly damaging Het
Ckap5 T A 2: 91,600,682 M1479K probably benign Het
Cpsf2 T C 12: 101,985,238 S145P probably damaging Het
Cyp4a12a A T 4: 115,326,702 H235L probably benign Het
Cyp7b1 A T 3: 18,097,506 F181Y probably damaging Het
Dennd5b T C 6: 149,044,755 T453A probably benign Het
Dlgap3 A G 4: 127,195,400 D263G probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Dync2li1 G A 17: 84,633,562 G69R probably damaging Het
Edc3 T C 9: 57,744,602 V331A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ganc C T 2: 120,411,539 T66I possibly damaging Het
Gm11595 C A 11: 99,772,317 C179F unknown Het
Gm13088 A G 4: 143,655,539 S196P possibly damaging Het
Gm15448 T A 7: 3,822,899 R324* probably null Het
Gnptg A G 17: 25,235,417 S159P probably damaging Het
Gsdmc2 C T 15: 63,826,210 V349I probably benign Het
Hydin T C 8: 110,533,214 I2606T possibly damaging Het
Ino80d A G 1: 63,058,840 S632P probably damaging Het
Kcnn2 G A 18: 45,559,396 R13H probably benign Het
Klb A T 5: 65,379,324 K666* probably null Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lmbrd2 A G 15: 9,182,570 K576E possibly damaging Het
Lrp2 T A 2: 69,480,153 Y2692F probably benign Het
Meis2 T A 2: 116,058,664 E202D probably benign Het
Mgat4c A T 10: 102,388,965 T347S probably damaging Het
Mmp12 G A 9: 7,347,501 C26Y possibly damaging Het
Mrpl24 G A 3: 87,922,985 R145Q probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Mycbpap T A 11: 94,505,610 R135W probably damaging Het
Myo1g T A 11: 6,507,000 Y942F probably benign Het
Myrf T C 19: 10,223,547 K52R probably null Het
Ncf2 A T 1: 152,821,518 silent Het
Olfr585 T C 7: 103,097,954 F71S probably damaging Het
Otx1 T C 11: 21,998,594 probably benign Het
Pcnx T A 12: 81,918,655 V532D possibly damaging Het
Pik3r5 T C 11: 68,492,270 L305P probably damaging Het
Polr3a A T 14: 24,450,698 C1341S probably benign Het
Ppp1r3a T C 6: 14,718,984 T644A probably benign Het
Ptbp1 A G 10: 79,859,932 D289G probably benign Het
Pwp2 A G 10: 78,172,118 F868L probably benign Het
Rgs8 A G 1: 153,692,828 E153G probably damaging Het
Rhbdf2 G A 11: 116,602,354 probably benign Het
Sbf1 T C 15: 89,308,068 H78R probably damaging Het
Sdr16c6 C T 4: 4,062,728 A197T possibly damaging Het
Slc36a3 A T 11: 55,125,721 Y349* probably null Het
Slc38a9 T C 13: 112,695,322 L202P possibly damaging Het
Slc40a1 A T 1: 45,912,349 M216K probably damaging Het
Slc9a3r2 A T 17: 24,644,877 M8K probably benign Het
Srebf1 T A 11: 60,203,584 Q568H possibly damaging Het
Srp54b A G 12: 55,252,829 N315S probably benign Het
Strc A G 2: 121,365,877 F1557L probably benign Het
Susd3 C A 13: 49,238,726 probably benign Het
Usp54 G A 14: 20,550,283 T1462I probably benign Het
Vmn1r11 T A 6: 57,137,802 N150K probably damaging Het
Vwa8 C T 14: 78,994,518 H606Y probably benign Het
Zmym6 A G 4: 127,100,670 I206V possibly damaging Het
Other mutations in Kpna7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Kpna7 APN 5 145007246 missense probably damaging 1.00
IGL01505:Kpna7 APN 5 144992851 missense probably damaging 1.00
IGL02009:Kpna7 APN 5 144994078 critical splice acceptor site probably null
IGL02365:Kpna7 APN 5 144985733 missense possibly damaging 0.49
IGL02947:Kpna7 APN 5 144994074 missense probably damaging 1.00
IGL03195:Kpna7 APN 5 144997037 missense probably damaging 1.00
IGL03236:Kpna7 APN 5 144985694 missense unknown
IGL03333:Kpna7 APN 5 145005955 missense possibly damaging 0.48
PIT4515001:Kpna7 UTSW 5 145005052 missense probably benign 0.17
R0027:Kpna7 UTSW 5 144989697 missense probably damaging 0.99
R0421:Kpna7 UTSW 5 144989741 missense possibly damaging 0.82
R0463:Kpna7 UTSW 5 145007994 missense possibly damaging 0.66
R2229:Kpna7 UTSW 5 144989697 missense probably damaging 0.99
R2871:Kpna7 UTSW 5 144993935 missense probably benign 0.06
R2871:Kpna7 UTSW 5 144993935 missense probably benign 0.06
R2873:Kpna7 UTSW 5 144993935 missense probably benign 0.06
R2874:Kpna7 UTSW 5 144993935 missense probably benign 0.06
R4079:Kpna7 UTSW 5 145005927 missense possibly damaging 0.82
R5888:Kpna7 UTSW 5 144989795 missense probably damaging 0.98
R6188:Kpna7 UTSW 5 144992844 missense probably damaging 1.00
R7163:Kpna7 UTSW 5 145002396 missense unknown
R7502:Kpna7 UTSW 5 145005921 missense probably benign 0.07
R7727:Kpna7 UTSW 5 145005045 missense probably benign 0.19
R8921:Kpna7 UTSW 5 145005030 missense probably damaging 1.00
X0021:Kpna7 UTSW 5 145007233 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CCTGACTCCCATCTGAGATTTG -3'
(R):5'- GAGTGACAGGTTTGCAATCC -3'

Sequencing Primer
(F):5'- CTAGAGCTCAGACTGGCTTTACG -3'
(R):5'- GAGTGACAGGTTTGCAATCCTTAGAC -3'
Posted On2016-12-20