Incidental Mutation 'R5841:Gm15448'
ID450436
Institutional Source Beutler Lab
Gene Symbol Gm15448
Ensembl Gene ENSMUSG00000074419
Gene Namepredicted gene 15448
SynonymsENSMUSG00000074419
MMRRC Submission 044061-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R5841 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location3816781-3825687 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 3822899 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 324 (R324*)
Ref Sequence ENSEMBL: ENSMUSP00000140974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094911] [ENSMUST00000108619] [ENSMUST00000108620] [ENSMUST00000153846] [ENSMUST00000189095]
Predicted Effect probably null
Transcript: ENSMUST00000094911
AA Change: R324*
SMART Domains Protein: ENSMUSP00000092515
Gene: ENSMUSG00000074419
AA Change: R324*

DomainStartEndE-ValueType
IG_like 40 105 3.26e0 SMART
IG 129 315 1.37e-1 SMART
IG_like 237 302 2.2e-1 SMART
IG 328 415 6.31e-1 SMART
IG 430 519 8.01e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108619
AA Change: R324*
SMART Domains Protein: ENSMUSP00000104259
Gene: ENSMUSG00000074419
AA Change: R324*

DomainStartEndE-ValueType
IG_like 40 105 3.26e0 SMART
IG 129 315 1.37e-1 SMART
IG_like 237 302 2.2e-1 SMART
IG 328 415 6.31e-1 SMART
IG_like 429 517 6.02e0 SMART
IG 529 618 8.01e-3 SMART
low complexity region 637 646 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108620
AA Change: R324*
SMART Domains Protein: ENSMUSP00000104260
Gene: ENSMUSG00000074419
AA Change: R324*

DomainStartEndE-ValueType
IG_like 40 105 3.26e0 SMART
IG 129 315 1.37e-1 SMART
IG_like 237 302 2.2e-1 SMART
IG 328 415 6.31e-1 SMART
IG 430 519 8.01e-3 SMART
low complexity region 538 547 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000153846
AA Change: R324*
SMART Domains Protein: ENSMUSP00000121707
Gene: ENSMUSG00000074419
AA Change: R324*

DomainStartEndE-ValueType
IG 7 96 8.01e-3 SMART
low complexity region 132 141 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000189095
AA Change: R324*
SMART Domains Protein: ENSMUSP00000140974
Gene: ENSMUSG00000074419
AA Change: R324*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG_like 40 105 1.3e-2 SMART
IG 129 315 5.7e-4 SMART
IG_like 237 302 9e-4 SMART
IG 328 415 2.6e-3 SMART
IG_like 429 517 2.4e-2 SMART
IG 529 618 3.3e-5 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A T 1: 75,174,350 F565L possibly damaging Het
Abhd6 T A 14: 8,049,596 V188D probably benign Het
Bbs12 T G 3: 37,319,521 N39K probably benign Het
Bend5 A G 4: 111,433,470 Y221C probably damaging Het
Brd8 A G 18: 34,605,523 S683P probably damaging Het
Caskin1 A G 17: 24,496,209 D79G probably damaging Het
Cdyl T C 13: 35,872,561 L509P probably damaging Het
Cenpf G T 1: 189,657,444 T1397N possibly damaging Het
Ckap5 T A 2: 91,600,682 M1479K probably benign Het
Cpsf2 T C 12: 101,985,238 S145P probably damaging Het
Cyp4a12a A T 4: 115,326,702 H235L probably benign Het
Cyp7b1 A T 3: 18,097,506 F181Y probably damaging Het
Dennd5b T C 6: 149,044,755 T453A probably benign Het
Dlgap3 A G 4: 127,195,400 D263G probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Dync2li1 G A 17: 84,633,562 G69R probably damaging Het
Edc3 T C 9: 57,744,602 V331A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ganc C T 2: 120,411,539 T66I possibly damaging Het
Gm11595 C A 11: 99,772,317 C179F unknown Het
Gm13088 A G 4: 143,655,539 S196P possibly damaging Het
Gnptg A G 17: 25,235,417 S159P probably damaging Het
Gsdmc2 C T 15: 63,826,210 V349I probably benign Het
Hydin T C 8: 110,533,214 I2606T possibly damaging Het
Ino80d A G 1: 63,058,840 S632P probably damaging Het
Kcnn2 G A 18: 45,559,396 R13H probably benign Het
Klb A T 5: 65,379,324 K666* probably null Het
Kmt2d G A 15: 98,852,109 probably benign Het
Kpna7 T C 5: 144,993,956 I360V possibly damaging Het
Lmbrd2 A G 15: 9,182,570 K576E possibly damaging Het
Lrp2 T A 2: 69,480,153 Y2692F probably benign Het
Meis2 T A 2: 116,058,664 E202D probably benign Het
Mgat4c A T 10: 102,388,965 T347S probably damaging Het
Mmp12 G A 9: 7,347,501 C26Y possibly damaging Het
Mrpl24 G A 3: 87,922,985 R145Q probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Mycbpap T A 11: 94,505,610 R135W probably damaging Het
Myo1g T A 11: 6,507,000 Y942F probably benign Het
Myrf T C 19: 10,223,547 K52R probably null Het
Ncf2 A T 1: 152,821,518 silent Het
Olfr585 T C 7: 103,097,954 F71S probably damaging Het
Otx1 T C 11: 21,998,594 probably benign Het
Pcnx T A 12: 81,918,655 V532D possibly damaging Het
Pik3r5 T C 11: 68,492,270 L305P probably damaging Het
Polr3a A T 14: 24,450,698 C1341S probably benign Het
Ppp1r3a T C 6: 14,718,984 T644A probably benign Het
Ptbp1 A G 10: 79,859,932 D289G probably benign Het
Pwp2 A G 10: 78,172,118 F868L probably benign Het
Rgs8 A G 1: 153,692,828 E153G probably damaging Het
Rhbdf2 G A 11: 116,602,354 probably benign Het
Sbf1 T C 15: 89,308,068 H78R probably damaging Het
Sdr16c6 C T 4: 4,062,728 A197T possibly damaging Het
Slc36a3 A T 11: 55,125,721 Y349* probably null Het
Slc38a9 T C 13: 112,695,322 L202P possibly damaging Het
Slc40a1 A T 1: 45,912,349 M216K probably damaging Het
Slc9a3r2 A T 17: 24,644,877 M8K probably benign Het
Srebf1 T A 11: 60,203,584 Q568H possibly damaging Het
Srp54b A G 12: 55,252,829 N315S probably benign Het
Strc A G 2: 121,365,877 F1557L probably benign Het
Susd3 C A 13: 49,238,726 probably benign Het
Usp54 G A 14: 20,550,283 T1462I probably benign Het
Vmn1r11 T A 6: 57,137,802 N150K probably damaging Het
Vwa8 C T 14: 78,994,518 H606Y probably benign Het
Zmym6 A G 4: 127,100,670 I206V possibly damaging Het
Other mutations in Gm15448
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Gm15448 APN 7 3823089 missense probably damaging 1.00
IGL01675:Gm15448 APN 7 3822608 splice site probably benign
IGL02040:Gm15448 APN 7 3821517 splice site probably benign
IGL02547:Gm15448 APN 7 3821661 missense probably damaging 0.98
IGL02749:Gm15448 APN 7 3822625 missense probably damaging 1.00
IGL02822:Gm15448 APN 7 3816918 missense possibly damaging 0.50
IGL02883:Gm15448 APN 7 3822180 missense possibly damaging 0.95
IGL03140:Gm15448 APN 7 3823248 missense probably benign 0.00
IGL03185:Gm15448 APN 7 3823230 missense probably damaging 1.00
IGL03212:Gm15448 APN 7 3823133 missense probably benign 0.00
R0347:Gm15448 UTSW 7 3822874 missense probably damaging 1.00
R0652:Gm15448 UTSW 7 3822763 missense probably benign 0.02
R0668:Gm15448 UTSW 7 3822700 missense probably damaging 0.99
R0724:Gm15448 UTSW 7 3816872 missense possibly damaging 0.83
R0735:Gm15448 UTSW 7 3821782 missense possibly damaging 0.79
R1074:Gm15448 UTSW 7 3823070 missense probably damaging 1.00
R1339:Gm15448 UTSW 7 3822156 missense probably damaging 1.00
R1541:Gm15448 UTSW 7 3816989 missense probably damaging 1.00
R1570:Gm15448 UTSW 7 3823061 missense probably benign 0.45
R1880:Gm15448 UTSW 7 3824951 critical splice donor site probably null
R1892:Gm15448 UTSW 7 3824574 missense probably benign 0.15
R1909:Gm15448 UTSW 7 3822919 missense probably benign 0.31
R2881:Gm15448 UTSW 7 3825641 start codon destroyed probably null 0.98
R2967:Gm15448 UTSW 7 3822687 missense probably damaging 1.00
R2983:Gm15448 UTSW 7 3821575 missense probably damaging 1.00
R4213:Gm15448 UTSW 7 3821554 missense probably damaging 1.00
R4319:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4320:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4321:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4322:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4323:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4536:Gm15448 UTSW 7 3822252 missense probably benign 0.00
R4597:Gm15448 UTSW 7 3822155 missense possibly damaging 0.81
R4713:Gm15448 UTSW 7 3822681 nonsense probably null
R4725:Gm15448 UTSW 7 3821548 missense probably benign
R4934:Gm15448 UTSW 7 3822677 missense probably damaging 1.00
R4971:Gm15448 UTSW 7 3822806 missense probably benign 0.00
R5138:Gm15448 UTSW 7 3824557 nonsense probably null
R5805:Gm15448 UTSW 7 3822623 missense probably benign 0.15
R5824:Gm15448 UTSW 7 3824754 missense probably damaging 1.00
R6027:Gm15448 UTSW 7 3824639 missense possibly damaging 0.94
R6214:Gm15448 UTSW 7 3821718 missense probably damaging 0.99
R6329:Gm15448 UTSW 7 3822851 missense probably damaging 1.00
R6429:Gm15448 UTSW 7 3822346 missense possibly damaging 0.63
R6650:Gm15448 UTSW 7 3816899 missense possibly damaging 0.83
R6681:Gm15448 UTSW 7 3822252 missense probably benign 0.00
R6961:Gm15448 UTSW 7 3825125 missense probably damaging 1.00
R6989:Gm15448 UTSW 7 3822164 missense possibly damaging 0.95
R7025:Gm15448 UTSW 7 3821262 nonsense probably null
R7071:Gm15448 UTSW 7 3821668 missense unknown
R7194:Gm15448 UTSW 7 3824793 missense
R7215:Gm15448 UTSW 7 3822311 missense unknown
R7580:Gm15448 UTSW 7 3824612 missense unknown
R7776:Gm15448 UTSW 7 3823247 missense unknown
R7863:Gm15448 UTSW 7 3824802 critical splice acceptor site probably null
R7909:Gm15448 UTSW 7 3821709 missense unknown
R8131:Gm15448 UTSW 7 3822162 nonsense probably null
R8178:Gm15448 UTSW 7 3821261 missense unknown
R8188:Gm15448 UTSW 7 3823127 missense unknown
R8220:Gm15448 UTSW 7 3822904 missense unknown
R8226:Gm15448 UTSW 7 3825110 missense
R8441:Gm15448 UTSW 7 3823302 nonsense probably null
R8739:Gm15448 UTSW 7 3825189 missense
R8785:Gm15448 UTSW 7 3816929 missense unknown
R8912:Gm15448 UTSW 7 3822819 missense unknown
R8941:Gm15448 UTSW 7 3822381 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGGCTTGGTACTGTCTAC -3'
(R):5'- AACATGCAGGGCAATATCGC -3'

Sequencing Primer
(F):5'- CAGGGCTTGGTACTGTCTACTAGAAG -3'
(R):5'- TTGGTCAGAGCCCAGTGACAC -3'
Posted On2016-12-20