Incidental Mutation 'R5841:Mgat4c'
ID450446
Institutional Source Beutler Lab
Gene Symbol Mgat4c
Ensembl Gene ENSMUSG00000019888
Gene NameMGAT4 family, member C
Synonyms9130411I17Rik
MMRRC Submission 044061-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5841 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location101681487-102391469 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102388965 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 347 (T347S)
Ref Sequence ENSEMBL: ENSMUSP00000135959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020039] [ENSMUST00000120748] [ENSMUST00000127504] [ENSMUST00000138522] [ENSMUST00000156751] [ENSMUST00000163753] [ENSMUST00000179929] [ENSMUST00000219195]
Predicted Effect probably damaging
Transcript: ENSMUST00000020039
AA Change: T347S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020039
Gene: ENSMUSG00000019888
AA Change: T347S

DomainStartEndE-ValueType
transmembrane domain 26 43 N/A INTRINSIC
Pfam:Glyco_transf_54 44 330 5.3e-112 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120748
AA Change: T347S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114010
Gene: ENSMUSG00000019888
AA Change: T347S

DomainStartEndE-ValueType
transmembrane domain 26 43 N/A INTRINSIC
Pfam:Glyco_transf_54 44 330 5.3e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127504
SMART Domains Protein: ENSMUSP00000117148
Gene: ENSMUSG00000019888

DomainStartEndE-ValueType
transmembrane domain 26 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138522
SMART Domains Protein: ENSMUSP00000118056
Gene: ENSMUSG00000019888

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
Pfam:Glyco_transf_54 43 150 1.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156751
SMART Domains Protein: ENSMUSP00000116216
Gene: ENSMUSG00000019888

DomainStartEndE-ValueType
transmembrane domain 26 43 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163753
AA Change: T347S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131551
Gene: ENSMUSG00000019888
AA Change: T347S

DomainStartEndE-ValueType
transmembrane domain 26 43 N/A INTRINSIC
Pfam:Glyco_transf_54 44 330 5.3e-112 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179929
AA Change: T347S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135959
Gene: ENSMUSG00000019888
AA Change: T347S

DomainStartEndE-ValueType
transmembrane domain 26 43 N/A INTRINSIC
Pfam:Glyco_transf_54 52 330 1.1e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219195
Meta Mutation Damage Score 0.2735 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A T 1: 75,174,350 F565L possibly damaging Het
Abhd6 T A 14: 8,049,596 V188D probably benign Het
Bbs12 T G 3: 37,319,521 N39K probably benign Het
Bend5 A G 4: 111,433,470 Y221C probably damaging Het
Brd8 A G 18: 34,605,523 S683P probably damaging Het
Caskin1 A G 17: 24,496,209 D79G probably damaging Het
Cdyl T C 13: 35,872,561 L509P probably damaging Het
Cenpf G T 1: 189,657,444 T1397N possibly damaging Het
Ckap5 T A 2: 91,600,682 M1479K probably benign Het
Cpsf2 T C 12: 101,985,238 S145P probably damaging Het
Cyp4a12a A T 4: 115,326,702 H235L probably benign Het
Cyp7b1 A T 3: 18,097,506 F181Y probably damaging Het
Dennd5b T C 6: 149,044,755 T453A probably benign Het
Dlgap3 A G 4: 127,195,400 D263G probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Dync2li1 G A 17: 84,633,562 G69R probably damaging Het
Edc3 T C 9: 57,744,602 V331A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ganc C T 2: 120,411,539 T66I possibly damaging Het
Gm11595 C A 11: 99,772,317 C179F unknown Het
Gm13088 A G 4: 143,655,539 S196P possibly damaging Het
Gm15448 T A 7: 3,822,899 R324* probably null Het
Gnptg A G 17: 25,235,417 S159P probably damaging Het
Gsdmc2 C T 15: 63,826,210 V349I probably benign Het
Hydin T C 8: 110,533,214 I2606T possibly damaging Het
Ino80d A G 1: 63,058,840 S632P probably damaging Het
Kcnn2 G A 18: 45,559,396 R13H probably benign Het
Klb A T 5: 65,379,324 K666* probably null Het
Kmt2d G A 15: 98,852,109 probably benign Het
Kpna7 T C 5: 144,993,956 I360V possibly damaging Het
Lmbrd2 A G 15: 9,182,570 K576E possibly damaging Het
Lrp2 T A 2: 69,480,153 Y2692F probably benign Het
Meis2 T A 2: 116,058,664 E202D probably benign Het
Mmp12 G A 9: 7,347,501 C26Y possibly damaging Het
Mrpl24 G A 3: 87,922,985 R145Q probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Mycbpap T A 11: 94,505,610 R135W probably damaging Het
Myo1g T A 11: 6,507,000 Y942F probably benign Het
Myrf T C 19: 10,223,547 K52R probably null Het
Ncf2 A T 1: 152,821,518 silent Het
Olfr585 T C 7: 103,097,954 F71S probably damaging Het
Otx1 T C 11: 21,998,594 probably benign Het
Pcnx T A 12: 81,918,655 V532D possibly damaging Het
Pik3r5 T C 11: 68,492,270 L305P probably damaging Het
Polr3a A T 14: 24,450,698 C1341S probably benign Het
Ppp1r3a T C 6: 14,718,984 T644A probably benign Het
Ptbp1 A G 10: 79,859,932 D289G probably benign Het
Pwp2 A G 10: 78,172,118 F868L probably benign Het
Rgs8 A G 1: 153,692,828 E153G probably damaging Het
Rhbdf2 G A 11: 116,602,354 probably benign Het
Sbf1 T C 15: 89,308,068 H78R probably damaging Het
Sdr16c6 C T 4: 4,062,728 A197T possibly damaging Het
Slc36a3 A T 11: 55,125,721 Y349* probably null Het
Slc38a9 T C 13: 112,695,322 L202P possibly damaging Het
Slc40a1 A T 1: 45,912,349 M216K probably damaging Het
Slc9a3r2 A T 17: 24,644,877 M8K probably benign Het
Srebf1 T A 11: 60,203,584 Q568H possibly damaging Het
Srp54b A G 12: 55,252,829 N315S probably benign Het
Strc A G 2: 121,365,877 F1557L probably benign Het
Susd3 C A 13: 49,238,726 probably benign Het
Usp54 G A 14: 20,550,283 T1462I probably benign Het
Vmn1r11 T A 6: 57,137,802 N150K probably damaging Het
Vwa8 C T 14: 78,994,518 H606Y probably benign Het
Zmym6 A G 4: 127,100,670 I206V possibly damaging Het
Other mutations in Mgat4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Mgat4c APN 10 102388720 missense probably damaging 1.00
IGL01293:Mgat4c APN 10 102388225 missense probably benign 0.00
IGL01394:Mgat4c APN 10 102385114 missense possibly damaging 0.62
IGL01525:Mgat4c APN 10 102378196 missense probably damaging 0.97
IGL02023:Mgat4c APN 10 102378184 nonsense probably null
IGL02150:Mgat4c APN 10 102389122 missense probably benign 0.08
IGL02296:Mgat4c APN 10 102385160 splice site probably benign
IGL02946:Mgat4c APN 10 102389253 missense probably benign 0.14
IGL03062:Mgat4c APN 10 102388461 missense probably damaging 1.00
R0001:Mgat4c UTSW 10 102388956 missense probably benign 0.01
R0326:Mgat4c UTSW 10 102388704 missense probably damaging 1.00
R0480:Mgat4c UTSW 10 102389119 missense probably damaging 0.97
R0656:Mgat4c UTSW 10 102388591 missense probably damaging 1.00
R0746:Mgat4c UTSW 10 102388687 missense probably damaging 1.00
R1639:Mgat4c UTSW 10 102378281 missense probably damaging 1.00
R1989:Mgat4c UTSW 10 102378159 start codon destroyed probably null 0.66
R2148:Mgat4c UTSW 10 102388929 missense probably benign
R2437:Mgat4c UTSW 10 102388575 missense probably damaging 1.00
R2567:Mgat4c UTSW 10 102378262 missense probably benign 0.38
R3780:Mgat4c UTSW 10 102388921 missense probably benign 0.25
R3781:Mgat4c UTSW 10 102388921 missense probably benign 0.25
R3782:Mgat4c UTSW 10 102388921 missense probably benign 0.25
R3786:Mgat4c UTSW 10 102385070 missense probably damaging 1.00
R3806:Mgat4c UTSW 10 102388360 missense probably benign 0.10
R4596:Mgat4c UTSW 10 102388561 missense probably damaging 1.00
R4718:Mgat4c UTSW 10 102388606 missense probably damaging 1.00
R4740:Mgat4c UTSW 10 102388404 missense probably damaging 1.00
R4872:Mgat4c UTSW 10 102388738 missense probably damaging 1.00
R5305:Mgat4c UTSW 10 102389279 missense possibly damaging 0.82
R5740:Mgat4c UTSW 10 102389321 missense possibly damaging 0.49
R6367:Mgat4c UTSW 10 102385154 critical splice donor site probably null
R6459:Mgat4c UTSW 10 102385127 missense probably damaging 1.00
R7021:Mgat4c UTSW 10 102388428 missense possibly damaging 0.82
R7122:Mgat4c UTSW 10 102378209 nonsense probably null
R7146:Mgat4c UTSW 10 102388496 missense probably damaging 1.00
R7629:Mgat4c UTSW 10 102389070 missense probably benign 0.03
R7877:Mgat4c UTSW 10 102385039 missense probably benign 0.00
R8829:Mgat4c UTSW 10 102378223 missense probably damaging 1.00
R8872:Mgat4c UTSW 10 102388285 missense probably damaging 1.00
RF020:Mgat4c UTSW 10 102389067 missense probably benign
X0020:Mgat4c UTSW 10 102388390 missense possibly damaging 0.67
Z1177:Mgat4c UTSW 10 102388450 missense probably damaging 1.00
Z1177:Mgat4c UTSW 10 102388602 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTATCAAGAAATGCCCTGCG -3'
(R):5'- CTAGGGCTCCATGTTGTAAGATG -3'

Sequencing Primer
(F):5'- CTATCAAGAAATGCCCTGCGATTGG -3'
(R):5'- AAGATGTCATTCTGCCGGTC -3'
Posted On2016-12-20