Incidental Mutation 'R0549:C4b'
ID45046
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Namecomplement component 4B (Chido blood group)
SynonymsC4, Ss
MMRRC Submission 038741-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0549 (G1)
Quality Score196
Status Validated
Chromosome17
Chromosomal Location34728380-34743882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 34735415 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 927 (L927I)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
Predicted Effect probably damaging
Transcript: ENSMUST00000069507
AA Change: L927I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: L927I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173057
SMART Domains Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
Pfam:A2M 1 62 6.5e-20 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 96% (48/50)
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A G 17: 46,322,290 F498L probably damaging Het
Adamts6 A T 13: 104,297,255 D64V possibly damaging Het
Agbl2 T C 2: 90,789,843 probably benign Het
Angptl3 A G 4: 99,031,455 S151G probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
Ccl3 T C 11: 83,648,336 T66A probably damaging Het
Cdh7 T C 1: 110,108,944 L618P probably damaging Het
Cfap65 T C 1: 74,918,444 T989A probably benign Het
Cnpy4 T C 5: 138,187,637 F18S possibly damaging Het
Col6a5 A G 9: 105,904,579 probably benign Het
Dppa2 G A 16: 48,318,671 R289H probably benign Het
Evx2 T C 2: 74,659,134 T96A probably benign Het
Frmd4a A G 2: 4,603,967 E577G possibly damaging Het
Gcgr G A 11: 120,536,561 G166S probably benign Het
Gm4788 A T 1: 139,739,488 D377E probably damaging Het
Gm5316 T C 6: 122,900,191 noncoding transcript Het
Gria1 G A 11: 57,228,973 R292Q probably damaging Het
Hars2 T A 18: 36,786,208 probably null Het
Hkdc1 T A 10: 62,400,240 T508S probably benign Het
Kif2b A T 11: 91,576,584 I291N probably damaging Het
Lmbrd1 A T 1: 24,744,920 T377S probably benign Het
Lrrc28 A G 7: 67,628,342 probably benign Het
Mmp3 A T 9: 7,455,638 N463I probably benign Het
Myh6 A G 14: 54,958,608 F578S probably damaging Het
Ncbp1 T A 4: 46,168,476 M608K possibly damaging Het
Nf1 T C 11: 79,468,771 F1412L probably damaging Het
Nlrp5 T A 7: 23,441,802 W1083R probably damaging Het
Nrsn1 T C 13: 25,262,258 Y45C probably benign Het
Olfr401 T G 11: 74,121,475 M62R probably damaging Het
Osbpl7 G T 11: 97,067,542 R881L probably damaging Het
Papss1 A G 3: 131,619,213 E456G possibly damaging Het
Pbxip1 T A 3: 89,443,592 probably benign Het
Pcca A G 14: 122,638,377 probably benign Het
Pde1a T A 2: 79,865,070 N511I probably damaging Het
Prpf39 A T 12: 65,056,256 I435F probably benign Het
Rnf213 C T 11: 119,465,082 T4117M probably damaging Het
Sel1l2 A T 2: 140,265,882 M216K probably damaging Het
Sidt2 A G 9: 45,953,119 probably null Het
Sirt3 A T 7: 140,869,487 probably null Het
Smpd4 T C 16: 17,639,312 V378A probably benign Het
Svil T A 18: 5,064,566 S642T possibly damaging Het
Tcp10a A G 17: 7,326,551 K92E probably benign Het
Tmem144 T C 3: 79,822,744 D233G probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnik T C 3: 28,570,920 S335P possibly damaging Het
Ush2a T C 1: 188,946,953 L4786P probably damaging Het
Utp11 A T 4: 124,686,079 probably benign Het
Vmn1r67 A G 7: 10,447,714 N241D probably damaging Het
Vmn2r11 A T 5: 109,052,097 C497S possibly damaging Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34734428 missense probably damaging 1.00
IGL00433:C4b APN 17 34742041 missense possibly damaging 0.75
IGL00471:C4b APN 17 34734429 missense probably damaging 1.00
IGL00515:C4b APN 17 34728891 missense probably damaging 1.00
IGL01599:C4b APN 17 34743019 splice site probably benign
IGL01761:C4b APN 17 34739938 missense possibly damaging 0.56
IGL02004:C4b APN 17 34739010 unclassified probably benign
IGL02215:C4b APN 17 34734491 missense probably damaging 1.00
IGL02517:C4b APN 17 34734408 missense probably benign 0.01
IGL02926:C4b APN 17 34730712 missense possibly damaging 0.95
IGL03031:C4b APN 17 34731130 missense possibly damaging 0.47
IGL03057:C4b APN 17 34737764 unclassified probably benign
IGL03165:C4b APN 17 34739955 missense probably benign 0.13
IGL03380:C4b APN 17 34740286 missense probably benign 0.01
Aspiration UTSW 17 34734442 missense probably benign 0.00
Inspiration UTSW 17 34732166 splice site probably null
Peroration UTSW 17 34729399 critical splice donor site probably null
perspiration UTSW 17 34729831 missense probably damaging 1.00
FR4548:C4b UTSW 17 34740997 missense probably benign 0.00
PIT4142001:C4b UTSW 17 34733701 missense probably benign 0.01
R0064:C4b UTSW 17 34738856 missense probably damaging 1.00
R0113:C4b UTSW 17 34741240 missense probably damaging 0.98
R0143:C4b UTSW 17 34734219 unclassified probably benign
R0254:C4b UTSW 17 34734776 missense probably benign 0.00
R0320:C4b UTSW 17 34733161 missense probably benign 0.01
R0391:C4b UTSW 17 34735614 splice site probably benign
R0399:C4b UTSW 17 34728869 missense probably damaging 1.00
R0467:C4b UTSW 17 34736127 missense probably benign 0.01
R0561:C4b UTSW 17 34734417 missense probably damaging 0.99
R0662:C4b UTSW 17 34730888 missense probably damaging 1.00
R0941:C4b UTSW 17 34740055 missense probably benign
R1161:C4b UTSW 17 34729593 missense probably damaging 1.00
R1169:C4b UTSW 17 34742972 missense probably benign 0.14
R1186:C4b UTSW 17 34736309 missense possibly damaging 0.47
R1310:C4b UTSW 17 34729593 missense probably damaging 1.00
R1398:C4b UTSW 17 34730719 unclassified probably benign
R1472:C4b UTSW 17 34743769 nonsense probably null
R1496:C4b UTSW 17 34740021 missense probably benign 0.30
R1544:C4b UTSW 17 34738967 missense probably benign 0.13
R1588:C4b UTSW 17 34741025 missense probably benign
R1645:C4b UTSW 17 34740597 missense probably damaging 1.00
R1664:C4b UTSW 17 34732978 missense probably damaging 1.00
R1678:C4b UTSW 17 34743650 missense probably benign 0.05
R1710:C4b UTSW 17 34743664 splice site probably benign
R1713:C4b UTSW 17 34729271 splice site probably benign
R1770:C4b UTSW 17 34736927 missense possibly damaging 0.78
R1859:C4b UTSW 17 34735553 missense probably benign
R1924:C4b UTSW 17 34729657 missense probably damaging 1.00
R2057:C4b UTSW 17 34728620 missense probably damaging 1.00
R2060:C4b UTSW 17 34736101 missense probably damaging 1.00
R2184:C4b UTSW 17 34737702 missense probably benign 0.27
R2306:C4b UTSW 17 34728518 missense probably benign 0.00
R2363:C4b UTSW 17 34736058 splice site probably benign
R2365:C4b UTSW 17 34736058 splice site probably benign
R2379:C4b UTSW 17 34735743 missense possibly damaging 0.81
R2860:C4b UTSW 17 34734758 missense probably damaging 0.99
R2861:C4b UTSW 17 34734758 missense probably damaging 0.99
R3551:C4b UTSW 17 34741872 missense possibly damaging 0.75
R3765:C4b UTSW 17 34729840 missense probably damaging 0.98
R4157:C4b UTSW 17 34742855 missense probably damaging 1.00
R4299:C4b UTSW 17 34731144 missense possibly damaging 0.52
R4365:C4b UTSW 17 34734743 missense possibly damaging 0.65
R4411:C4b UTSW 17 34728864 missense probably damaging 1.00
R4613:C4b UTSW 17 34734551 missense probably benign 0.12
R4784:C4b UTSW 17 34733406 missense probably benign 0.00
R4790:C4b UTSW 17 34734143 missense probably benign 0.01
R4831:C4b UTSW 17 34736890 splice site probably null
R4879:C4b UTSW 17 34743647 missense probably damaging 0.99
R5036:C4b UTSW 17 34740445 critical splice acceptor site probably null
R5361:C4b UTSW 17 34741238 missense probably benign 0.15
R5384:C4b UTSW 17 34737661 missense possibly damaging 0.89
R5518:C4b UTSW 17 34734442 missense probably benign 0.00
R5590:C4b UTSW 17 34740335 missense probably damaging 0.98
R5643:C4b UTSW 17 34742417 missense probably benign 0.01
R5644:C4b UTSW 17 34742417 missense probably benign 0.01
R5833:C4b UTSW 17 34730673 missense probably damaging 1.00
R5931:C4b UTSW 17 34729193 missense probably damaging 0.99
R6178:C4b UTSW 17 34733406 missense probably benign 0.00
R6209:C4b UTSW 17 34741087 missense possibly damaging 0.93
R6225:C4b UTSW 17 34738874 missense possibly damaging 0.64
R6518:C4b UTSW 17 34734205 missense probably damaging 0.98
R6613:C4b UTSW 17 34733565 missense probably damaging 0.99
R6781:C4b UTSW 17 34742954 missense probably damaging 0.99
R6807:C4b UTSW 17 34730956 missense probably benign 0.17
R6858:C4b UTSW 17 34729831 missense probably damaging 1.00
R6962:C4b UTSW 17 34732166 splice site probably null
R7068:C4b UTSW 17 34733477 missense probably damaging 1.00
R7081:C4b UTSW 17 34735443 missense probably benign 0.27
R7105:C4b UTSW 17 34730911 missense possibly damaging 0.52
R7211:C4b UTSW 17 34735534 missense possibly damaging 0.92
R7296:C4b UTSW 17 34743659 missense probably damaging 1.00
R7314:C4b UTSW 17 34740356 missense probably benign
R7330:C4b UTSW 17 34730472 missense probably damaging 1.00
R7397:C4b UTSW 17 34742390 missense possibly damaging 0.80
R7437:C4b UTSW 17 34734733 missense probably benign 0.10
R7490:C4b UTSW 17 34731080 nonsense probably null
R7597:C4b UTSW 17 34739675 missense probably benign
R7633:C4b UTSW 17 34729399 critical splice donor site probably null
R7900:C4b UTSW 17 34739777 missense probably benign 0.03
R7910:C4b UTSW 17 34740352 missense probably benign 0.00
R7923:C4b UTSW 17 34742380 missense probably damaging 1.00
R7960:C4b UTSW 17 34741278 splice site probably null
R8420:C4b UTSW 17 34734539 missense probably damaging 0.97
R8467:C4b UTSW 17 34732813 missense possibly damaging 0.51
R8558:C4b UTSW 17 34736567 missense probably damaging 1.00
R8725:C4b UTSW 17 34734485 missense probably damaging 1.00
R8727:C4b UTSW 17 34734485 missense probably damaging 1.00
Z1176:C4b UTSW 17 34731147 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACTTCCCAGTCAGAAACAGGGACTC -3'
(R):5'- AGTGTCCATGTGACCCCAGTTGAG -3'

Sequencing Primer
(F):5'- aaaggcaaaggcagggg -3'
(R):5'- CCCAGTTGAGGGGCTGTG -3'
Posted On2013-06-11