Incidental Mutation 'R5841:Dync2li1'
ID450471
Institutional Source Beutler Lab
Gene Symbol Dync2li1
Ensembl Gene ENSMUSG00000024253
Gene Namedynein cytoplasmic 2 light intermediate chain 1
SynonymsmD2LIC, 4933404O11Rik, LIC3, D2lic, CGI-60
MMRRC Submission 044061-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5841 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location84626496-84655558 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84633562 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 69 (G69R)
Ref Sequence ENSEMBL: ENSMUSP00000025101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025101]
Predicted Effect probably damaging
Transcript: ENSMUST00000025101
AA Change: G69R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000025101
Gene: ENSMUSG00000024253
AA Change: G69R

DomainStartEndE-ValueType
Pfam:DLIC 2 179 3.3e-8 PFAM
Meta Mutation Damage Score 0.8460 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a component of the dynein-2 microtubule motor protein complex that plays a role in the retrograde transport of cargo in primary cilia via the intraflagellar transport system. This gene is ubiquitously expressed and its protein, which localizes to the axoneme and Golgi apparatus, interacts directly with the cytoplasmic dynein 2 heavy chain 1 protein to form part of the multi-protein dynein-2 complex. Mutations in this gene produce defects in the dynein-2 complex which result in several types of ciliopathy including short-rib thoracic dysplasia 15 with polydactyly (SRTD15). Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for disruptions in this allele die before embryonic day 11.5. They display neural tube defects in addition to a variety developmental patterning abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A T 1: 75,174,350 F565L possibly damaging Het
Abhd6 T A 14: 8,049,596 V188D probably benign Het
Bbs12 T G 3: 37,319,521 N39K probably benign Het
Bend5 A G 4: 111,433,470 Y221C probably damaging Het
Brd8 A G 18: 34,605,523 S683P probably damaging Het
Caskin1 A G 17: 24,496,209 D79G probably damaging Het
Cdyl T C 13: 35,872,561 L509P probably damaging Het
Cenpf G T 1: 189,657,444 T1397N possibly damaging Het
Ckap5 T A 2: 91,600,682 M1479K probably benign Het
Cpsf2 T C 12: 101,985,238 S145P probably damaging Het
Cyp4a12a A T 4: 115,326,702 H235L probably benign Het
Cyp7b1 A T 3: 18,097,506 F181Y probably damaging Het
Dennd5b T C 6: 149,044,755 T453A probably benign Het
Dlgap3 A G 4: 127,195,400 D263G probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Edc3 T C 9: 57,744,602 V331A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ganc C T 2: 120,411,539 T66I possibly damaging Het
Gm11595 C A 11: 99,772,317 C179F unknown Het
Gm13088 A G 4: 143,655,539 S196P possibly damaging Het
Gm15448 T A 7: 3,822,899 R324* probably null Het
Gnptg A G 17: 25,235,417 S159P probably damaging Het
Gsdmc2 C T 15: 63,826,210 V349I probably benign Het
Hydin T C 8: 110,533,214 I2606T possibly damaging Het
Ino80d A G 1: 63,058,840 S632P probably damaging Het
Kcnn2 G A 18: 45,559,396 R13H probably benign Het
Klb A T 5: 65,379,324 K666* probably null Het
Kmt2d G A 15: 98,852,109 probably benign Het
Kpna7 T C 5: 144,993,956 I360V possibly damaging Het
Lmbrd2 A G 15: 9,182,570 K576E possibly damaging Het
Lrp2 T A 2: 69,480,153 Y2692F probably benign Het
Meis2 T A 2: 116,058,664 E202D probably benign Het
Mgat4c A T 10: 102,388,965 T347S probably damaging Het
Mmp12 G A 9: 7,347,501 C26Y possibly damaging Het
Mrpl24 G A 3: 87,922,985 R145Q probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Mycbpap T A 11: 94,505,610 R135W probably damaging Het
Myo1g T A 11: 6,507,000 Y942F probably benign Het
Myrf T C 19: 10,223,547 K52R probably null Het
Ncf2 A T 1: 152,821,518 silent Het
Olfr585 T C 7: 103,097,954 F71S probably damaging Het
Otx1 T C 11: 21,998,594 probably benign Het
Pcnx T A 12: 81,918,655 V532D possibly damaging Het
Pik3r5 T C 11: 68,492,270 L305P probably damaging Het
Polr3a A T 14: 24,450,698 C1341S probably benign Het
Ppp1r3a T C 6: 14,718,984 T644A probably benign Het
Ptbp1 A G 10: 79,859,932 D289G probably benign Het
Pwp2 A G 10: 78,172,118 F868L probably benign Het
Rgs8 A G 1: 153,692,828 E153G probably damaging Het
Rhbdf2 G A 11: 116,602,354 probably benign Het
Sbf1 T C 15: 89,308,068 H78R probably damaging Het
Sdr16c6 C T 4: 4,062,728 A197T possibly damaging Het
Slc36a3 A T 11: 55,125,721 Y349* probably null Het
Slc38a9 T C 13: 112,695,322 L202P possibly damaging Het
Slc40a1 A T 1: 45,912,349 M216K probably damaging Het
Slc9a3r2 A T 17: 24,644,877 M8K probably benign Het
Srebf1 T A 11: 60,203,584 Q568H possibly damaging Het
Srp54b A G 12: 55,252,829 N315S probably benign Het
Strc A G 2: 121,365,877 F1557L probably benign Het
Susd3 C A 13: 49,238,726 probably benign Het
Usp54 G A 14: 20,550,283 T1462I probably benign Het
Vmn1r11 T A 6: 57,137,802 N150K probably damaging Het
Vwa8 C T 14: 78,994,518 H606Y probably benign Het
Zmym6 A G 4: 127,100,670 I206V possibly damaging Het
Other mutations in Dync2li1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Dync2li1 APN 17 84644726 missense possibly damaging 0.86
IGL00661:Dync2li1 APN 17 84649240 missense possibly damaging 0.88
IGL01450:Dync2li1 APN 17 84633556 missense possibly damaging 0.53
IGL01610:Dync2li1 APN 17 84628314 missense probably damaging 1.00
R0387:Dync2li1 UTSW 17 84655340 missense possibly damaging 0.69
R0883:Dync2li1 UTSW 17 84649271 missense probably benign 0.01
R1499:Dync2li1 UTSW 17 84647239 splice site probably benign
R1823:Dync2li1 UTSW 17 84649797 missense probably damaging 0.98
R2164:Dync2li1 UTSW 17 84636274 missense probably damaging 1.00
R2394:Dync2li1 UTSW 17 84644747 missense possibly damaging 0.94
R2443:Dync2li1 UTSW 17 84647665 missense probably benign 0.30
R3901:Dync2li1 UTSW 17 84631642 missense probably damaging 1.00
R4151:Dync2li1 UTSW 17 84628335 missense probably benign 0.00
R4934:Dync2li1 UTSW 17 84649255 missense probably benign
R4960:Dync2li1 UTSW 17 84633541 missense probably benign 0.07
R5340:Dync2li1 UTSW 17 84649702 splice site probably null
R6230:Dync2li1 UTSW 17 84647650 missense probably damaging 0.97
R7331:Dync2li1 UTSW 17 84647658 nonsense probably null
R7447:Dync2li1 UTSW 17 84647713 missense possibly damaging 0.77
R8492:Dync2li1 UTSW 17 84649706 splice site probably null
R8827:Dync2li1 UTSW 17 84647651 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TCGGGCATCGTTGTTCACTC -3'
(R):5'- GATTACACGGACTTCCTGCCAG -3'

Sequencing Primer
(F):5'- CCCAGGACAGTGTTTGAGG -3'
(R):5'- AGCTGAGCTGCACGTGAG -3'
Posted On2016-12-20