Incidental Mutation 'R5841:Brd8'
ID450472
Institutional Source Beutler Lab
Gene Symbol Brd8
Ensembl Gene ENSMUSG00000003778
Gene Namebromodomain containing 8
Synonyms2610007E11Rik, 4432404P07Rik, SMAP, p120
MMRRC Submission 044061-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5841 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location34598615-34624601 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34605523 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 683 (S683P)
Ref Sequence ENSEMBL: ENSMUSP00000111432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003876] [ENSMUST00000097626] [ENSMUST00000115765] [ENSMUST00000115766]
Predicted Effect probably damaging
Transcript: ENSMUST00000003876
AA Change: S753P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000003876
Gene: ENSMUSG00000003778
AA Change: S753P

DomainStartEndE-ValueType
Blast:SANT 15 74 4e-33 BLAST
coiled coil region 97 132 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
low complexity region 265 282 N/A INTRINSIC
low complexity region 323 339 N/A INTRINSIC
low complexity region 363 378 N/A INTRINSIC
low complexity region 386 404 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
low complexity region 759 773 N/A INTRINSIC
BROMO 778 886 7.59e-40 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097626
AA Change: S680P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095229
Gene: ENSMUSG00000003778
AA Change: S680P

DomainStartEndE-ValueType
Blast:SANT 15 74 3e-33 BLAST
coiled coil region 97 132 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
low complexity region 250 266 N/A INTRINSIC
low complexity region 290 305 N/A INTRINSIC
low complexity region 313 331 N/A INTRINSIC
low complexity region 432 443 N/A INTRINSIC
low complexity region 686 700 N/A INTRINSIC
BROMO 705 813 7.59e-40 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115765
AA Change: S753P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111431
Gene: ENSMUSG00000003778
AA Change: S753P

DomainStartEndE-ValueType
Blast:SANT 15 74 5e-33 BLAST
coiled coil region 97 132 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
low complexity region 265 282 N/A INTRINSIC
low complexity region 323 339 N/A INTRINSIC
low complexity region 363 378 N/A INTRINSIC
low complexity region 386 404 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
low complexity region 759 773 N/A INTRINSIC
BROMO 778 886 7.59e-40 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115766
AA Change: S683P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111432
Gene: ENSMUSG00000003778
AA Change: S683P

DomainStartEndE-ValueType
Blast:SANT 15 74 4e-33 BLAST
coiled coil region 97 132 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
low complexity region 265 282 N/A INTRINSIC
low complexity region 323 337 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 689 703 N/A INTRINSIC
BROMO 708 816 7.59e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153569
Meta Mutation Damage Score 0.0731 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with thyroid hormone receptor in a ligand-dependent manner and enhances thyroid hormone-dependent activation from thyroid response elements. This protein contains a bromodomain and is thought to be a nuclear receptor coactivator. Multiple alternatively spliced transcript variants that encode distinct isoforms have been identified. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A T 1: 75,174,350 F565L possibly damaging Het
Abhd6 T A 14: 8,049,596 V188D probably benign Het
Bbs12 T G 3: 37,319,521 N39K probably benign Het
Bend5 A G 4: 111,433,470 Y221C probably damaging Het
Caskin1 A G 17: 24,496,209 D79G probably damaging Het
Cdyl T C 13: 35,872,561 L509P probably damaging Het
Cenpf G T 1: 189,657,444 T1397N possibly damaging Het
Ckap5 T A 2: 91,600,682 M1479K probably benign Het
Cpsf2 T C 12: 101,985,238 S145P probably damaging Het
Cyp4a12a A T 4: 115,326,702 H235L probably benign Het
Cyp7b1 A T 3: 18,097,506 F181Y probably damaging Het
Dennd5b T C 6: 149,044,755 T453A probably benign Het
Dlgap3 A G 4: 127,195,400 D263G probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Dync2li1 G A 17: 84,633,562 G69R probably damaging Het
Edc3 T C 9: 57,744,602 V331A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ganc C T 2: 120,411,539 T66I possibly damaging Het
Gm11595 C A 11: 99,772,317 C179F unknown Het
Gm13088 A G 4: 143,655,539 S196P possibly damaging Het
Gm15448 T A 7: 3,822,899 R324* probably null Het
Gnptg A G 17: 25,235,417 S159P probably damaging Het
Gsdmc2 C T 15: 63,826,210 V349I probably benign Het
Hydin T C 8: 110,533,214 I2606T possibly damaging Het
Ino80d A G 1: 63,058,840 S632P probably damaging Het
Kcnn2 G A 18: 45,559,396 R13H probably benign Het
Klb A T 5: 65,379,324 K666* probably null Het
Kmt2d G A 15: 98,852,109 probably benign Het
Kpna7 T C 5: 144,993,956 I360V possibly damaging Het
Lmbrd2 A G 15: 9,182,570 K576E possibly damaging Het
Lrp2 T A 2: 69,480,153 Y2692F probably benign Het
Meis2 T A 2: 116,058,664 E202D probably benign Het
Mgat4c A T 10: 102,388,965 T347S probably damaging Het
Mmp12 G A 9: 7,347,501 C26Y possibly damaging Het
Mrpl24 G A 3: 87,922,985 R145Q probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Mycbpap T A 11: 94,505,610 R135W probably damaging Het
Myo1g T A 11: 6,507,000 Y942F probably benign Het
Myrf T C 19: 10,223,547 K52R probably null Het
Ncf2 A T 1: 152,821,518 silent Het
Olfr585 T C 7: 103,097,954 F71S probably damaging Het
Otx1 T C 11: 21,998,594 probably benign Het
Pcnx T A 12: 81,918,655 V532D possibly damaging Het
Pik3r5 T C 11: 68,492,270 L305P probably damaging Het
Polr3a A T 14: 24,450,698 C1341S probably benign Het
Ppp1r3a T C 6: 14,718,984 T644A probably benign Het
Ptbp1 A G 10: 79,859,932 D289G probably benign Het
Pwp2 A G 10: 78,172,118 F868L probably benign Het
Rgs8 A G 1: 153,692,828 E153G probably damaging Het
Rhbdf2 G A 11: 116,602,354 probably benign Het
Sbf1 T C 15: 89,308,068 H78R probably damaging Het
Sdr16c6 C T 4: 4,062,728 A197T possibly damaging Het
Slc36a3 A T 11: 55,125,721 Y349* probably null Het
Slc38a9 T C 13: 112,695,322 L202P possibly damaging Het
Slc40a1 A T 1: 45,912,349 M216K probably damaging Het
Slc9a3r2 A T 17: 24,644,877 M8K probably benign Het
Srebf1 T A 11: 60,203,584 Q568H possibly damaging Het
Srp54b A G 12: 55,252,829 N315S probably benign Het
Strc A G 2: 121,365,877 F1557L probably benign Het
Susd3 C A 13: 49,238,726 probably benign Het
Usp54 G A 14: 20,550,283 T1462I probably benign Het
Vmn1r11 T A 6: 57,137,802 N150K probably damaging Het
Vwa8 C T 14: 78,994,518 H606Y probably benign Het
Zmym6 A G 4: 127,100,670 I206V possibly damaging Het
Other mutations in Brd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Brd8 APN 18 34609883 nonsense probably null
IGL01734:Brd8 APN 18 34614805 splice site probably benign
IGL02064:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02065:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02067:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02118:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02120:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02121:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02122:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02123:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02125:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02126:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02160:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02163:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02164:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02166:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02211:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02212:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02216:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02217:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02219:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02397:Brd8 APN 18 34604873 missense probably damaging 0.99
IGL02642:Brd8 APN 18 34608064 splice site probably benign
IGL02820:Brd8 APN 18 34607301 missense probably benign 0.01
IGL02942:Brd8 APN 18 34610627 missense possibly damaging 0.92
IGL03121:Brd8 APN 18 34606687 missense probably damaging 0.99
IGL03174:Brd8 APN 18 34604909 missense probably damaging 1.00
IGL03304:Brd8 APN 18 34614580 splice site probably benign
R0226:Brd8 UTSW 18 34603894 splice site probably benign
R1269:Brd8 UTSW 18 34609804 critical splice donor site probably null
R1654:Brd8 UTSW 18 34611226 missense probably damaging 1.00
R1692:Brd8 UTSW 18 34609833 missense probably damaging 0.99
R1714:Brd8 UTSW 18 34609833 missense probably damaging 0.99
R1874:Brd8 UTSW 18 34610474 missense probably damaging 1.00
R1965:Brd8 UTSW 18 34602766 missense probably damaging 1.00
R1973:Brd8 UTSW 18 34608013 missense probably damaging 1.00
R2069:Brd8 UTSW 18 34614479 missense probably damaging 1.00
R3952:Brd8 UTSW 18 34614444 splice site probably benign
R4411:Brd8 UTSW 18 34623444 unclassified probably benign
R4634:Brd8 UTSW 18 34608484 missense possibly damaging 0.78
R4650:Brd8 UTSW 18 34606699 missense probably benign 0.06
R4919:Brd8 UTSW 18 34607436 missense probably damaging 0.99
R4925:Brd8 UTSW 18 34607335 missense probably benign 0.02
R4948:Brd8 UTSW 18 34614532 missense probably damaging 1.00
R5328:Brd8 UTSW 18 34607981 missense probably benign 0.29
R5489:Brd8 UTSW 18 34608645 intron probably null
R6306:Brd8 UTSW 18 34611251 missense probably damaging 0.97
R6320:Brd8 UTSW 18 34613239 missense possibly damaging 0.68
R6808:Brd8 UTSW 18 34608475 missense probably damaging 0.98
R7149:Brd8 UTSW 18 34604597 critical splice donor site probably null
R7876:Brd8 UTSW 18 34606687 missense probably benign 0.00
R7959:Brd8 UTSW 18 34606687 missense probably benign 0.00
R8002:Brd8 UTSW 18 34608556 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGTTTCAAGCCAAGAAAGGG -3'
(R):5'- GTATCTAAGGATGCCCCAGGTG -3'

Sequencing Primer
(F):5'- CTCAAAAAGTCCTGGGTTCAGTCAG -3'
(R):5'- ATGCCCCAGGTGACGATGAG -3'
Posted On2016-12-20