Incidental Mutation 'R5841:Kcnn2'
ID450473
Institutional Source Beutler Lab
Gene Symbol Kcnn2
Ensembl Gene ENSMUSG00000054477
Gene Namepotassium intermediate/small conductance calcium-activated channel, subfamily N, member 2
Synonymsfri, SK2, small conductance calcium-activated potassium channel 2, bc
MMRRC Submission 044061-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R5841 (G1)
Quality Score217
Status Validated
Chromosome18
Chromosomal Location45268860-45686024 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45559396 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 13 (R13H)
Ref Sequence ENSEMBL: ENSMUSP00000067884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066890] [ENSMUST00000169783] [ENSMUST00000183850] [ENSMUST00000211323]
Predicted Effect probably benign
Transcript: ENSMUST00000066890
AA Change: R13H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000067884
Gene: ENSMUSG00000054477
AA Change: R13H

DomainStartEndE-ValueType
low complexity region 62 76 N/A INTRINSIC
low complexity region 84 90 N/A INTRINSIC
low complexity region 98 114 N/A INTRINSIC
low complexity region 129 141 N/A INTRINSIC
low complexity region 158 180 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
low complexity region 219 254 N/A INTRINSIC
low complexity region 279 289 N/A INTRINSIC
low complexity region 301 326 N/A INTRINSIC
low complexity region 345 373 N/A INTRINSIC
Pfam:SK_channel 380 493 2.2e-51 PFAM
transmembrane domain 516 535 N/A INTRINSIC
Pfam:Ion_trans_2 572 658 2.2e-14 PFAM
CaMBD 672 748 6.51e-51 SMART
coiled coil region 751 784 N/A INTRINSIC
low complexity region 815 839 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167895
SMART Domains Protein: ENSMUSP00000126285
Gene: ENSMUSG00000054477

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
low complexity region 36 61 N/A INTRINSIC
low complexity region 80 108 N/A INTRINSIC
Pfam:SK_channel 115 233 7e-61 PFAM
transmembrane domain 251 270 N/A INTRINSIC
Pfam:Ion_trans_2 306 394 6.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169783
SMART Domains Protein: ENSMUSP00000129659
Gene: ENSMUSG00000054477

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
low complexity region 36 61 N/A INTRINSIC
low complexity region 80 108 N/A INTRINSIC
Pfam:SK_channel 115 215 1.4e-36 PFAM
Pfam:Ion_trans_2 169 254 9.5e-15 PFAM
CaMBD 267 343 6.51e-51 SMART
coiled coil region 346 379 N/A INTRINSIC
low complexity region 410 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183850
SMART Domains Protein: ENSMUSP00000139350
Gene: ENSMUSG00000054477

DomainStartEndE-ValueType
low complexity region 62 76 N/A INTRINSIC
low complexity region 84 90 N/A INTRINSIC
low complexity region 98 114 N/A INTRINSIC
low complexity region 129 141 N/A INTRINSIC
low complexity region 158 180 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
low complexity region 219 254 N/A INTRINSIC
low complexity region 279 289 N/A INTRINSIC
low complexity region 301 326 N/A INTRINSIC
low complexity region 345 373 N/A INTRINSIC
Pfam:SK_channel 380 498 2.9e-60 PFAM
transmembrane domain 516 535 N/A INTRINSIC
Pfam:Ion_trans_2 573 659 1.8e-14 PFAM
CaMBD 672 748 6.51e-51 SMART
coiled coil region 751 784 N/A INTRINSIC
low complexity region 815 839 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184101
Predicted Effect probably benign
Transcript: ENSMUST00000211323
Meta Mutation Damage Score 0.0689 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (67/67)
MGI Phenotype PHENOTYPE: Mice homozygous for a point mutation exhibit tremor and gait abnormalities. Homozygous null mice lack the apamin sensitive component of the medium afterhyperpolarization current but have normal hippocampal morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A T 1: 75,174,350 F565L possibly damaging Het
Abhd6 T A 14: 8,049,596 V188D probably benign Het
Bbs12 T G 3: 37,319,521 N39K probably benign Het
Bend5 A G 4: 111,433,470 Y221C probably damaging Het
Brd8 A G 18: 34,605,523 S683P probably damaging Het
Caskin1 A G 17: 24,496,209 D79G probably damaging Het
Cdyl T C 13: 35,872,561 L509P probably damaging Het
Cenpf G T 1: 189,657,444 T1397N possibly damaging Het
Ckap5 T A 2: 91,600,682 M1479K probably benign Het
Cpsf2 T C 12: 101,985,238 S145P probably damaging Het
Cyp4a12a A T 4: 115,326,702 H235L probably benign Het
Cyp7b1 A T 3: 18,097,506 F181Y probably damaging Het
Dennd5b T C 6: 149,044,755 T453A probably benign Het
Dlgap3 A G 4: 127,195,400 D263G probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Dync2li1 G A 17: 84,633,562 G69R probably damaging Het
Edc3 T C 9: 57,744,602 V331A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ganc C T 2: 120,411,539 T66I possibly damaging Het
Gm11595 C A 11: 99,772,317 C179F unknown Het
Gm13088 A G 4: 143,655,539 S196P possibly damaging Het
Gm15448 T A 7: 3,822,899 R324* probably null Het
Gnptg A G 17: 25,235,417 S159P probably damaging Het
Gsdmc2 C T 15: 63,826,210 V349I probably benign Het
Hydin T C 8: 110,533,214 I2606T possibly damaging Het
Ino80d A G 1: 63,058,840 S632P probably damaging Het
Klb A T 5: 65,379,324 K666* probably null Het
Kmt2d G A 15: 98,852,109 probably benign Het
Kpna7 T C 5: 144,993,956 I360V possibly damaging Het
Lmbrd2 A G 15: 9,182,570 K576E possibly damaging Het
Lrp2 T A 2: 69,480,153 Y2692F probably benign Het
Meis2 T A 2: 116,058,664 E202D probably benign Het
Mgat4c A T 10: 102,388,965 T347S probably damaging Het
Mmp12 G A 9: 7,347,501 C26Y possibly damaging Het
Mrpl24 G A 3: 87,922,985 R145Q probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Mycbpap T A 11: 94,505,610 R135W probably damaging Het
Myo1g T A 11: 6,507,000 Y942F probably benign Het
Myrf T C 19: 10,223,547 K52R probably null Het
Ncf2 A T 1: 152,821,518 silent Het
Olfr585 T C 7: 103,097,954 F71S probably damaging Het
Otx1 T C 11: 21,998,594 probably benign Het
Pcnx T A 12: 81,918,655 V532D possibly damaging Het
Pik3r5 T C 11: 68,492,270 L305P probably damaging Het
Polr3a A T 14: 24,450,698 C1341S probably benign Het
Ppp1r3a T C 6: 14,718,984 T644A probably benign Het
Ptbp1 A G 10: 79,859,932 D289G probably benign Het
Pwp2 A G 10: 78,172,118 F868L probably benign Het
Rgs8 A G 1: 153,692,828 E153G probably damaging Het
Rhbdf2 G A 11: 116,602,354 probably benign Het
Sbf1 T C 15: 89,308,068 H78R probably damaging Het
Sdr16c6 C T 4: 4,062,728 A197T possibly damaging Het
Slc36a3 A T 11: 55,125,721 Y349* probably null Het
Slc38a9 T C 13: 112,695,322 L202P possibly damaging Het
Slc40a1 A T 1: 45,912,349 M216K probably damaging Het
Slc9a3r2 A T 17: 24,644,877 M8K probably benign Het
Srebf1 T A 11: 60,203,584 Q568H possibly damaging Het
Srp54b A G 12: 55,252,829 N315S probably benign Het
Strc A G 2: 121,365,877 F1557L probably benign Het
Susd3 C A 13: 49,238,726 probably benign Het
Usp54 G A 14: 20,550,283 T1462I probably benign Het
Vmn1r11 T A 6: 57,137,802 N150K probably damaging Het
Vwa8 C T 14: 78,994,518 H606Y probably benign Het
Zmym6 A G 4: 127,100,670 I206V possibly damaging Het
Other mutations in Kcnn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Kcnn2 APN 18 45592236 missense probably damaging 0.98
IGL00341:Kcnn2 APN 18 45677071 splice site probably benign
IGL01317:Kcnn2 APN 18 45560627 splice site probably null
IGL02121:Kcnn2 APN 18 45561273 missense probably damaging 0.98
IGL02561:Kcnn2 APN 18 45592192 missense possibly damaging 0.59
IGL03000:Kcnn2 APN 18 45560568 missense probably damaging 0.97
IGL03116:Kcnn2 APN 18 45655206 missense probably damaging 1.00
IGL03155:Kcnn2 APN 18 45685315 missense probably damaging 0.99
IGL03289:Kcnn2 APN 18 45677044 missense probably damaging 1.00
IGL03343:Kcnn2 APN 18 45676959 missense probably damaging 0.97
jitter UTSW 18 45561253 synonymous silent
I2288:Kcnn2 UTSW 18 45675273 intron probably benign
R0256:Kcnn2 UTSW 18 45592405 missense probably damaging 0.98
R0310:Kcnn2 UTSW 18 45560518 missense probably damaging 1.00
R0464:Kcnn2 UTSW 18 45560359 missense probably damaging 0.99
R0468:Kcnn2 UTSW 18 45559471 missense possibly damaging 0.96
R0485:Kcnn2 UTSW 18 45560148 missense probably benign 0.06
R0722:Kcnn2 UTSW 18 45559476 missense possibly damaging 0.73
R0898:Kcnn2 UTSW 18 45559476 missense possibly damaging 0.73
R1567:Kcnn2 UTSW 18 45670334 splice site probably null
R4543:Kcnn2 UTSW 18 45559648 missense probably benign 0.00
R4720:Kcnn2 UTSW 18 45683120 missense possibly damaging 0.78
R4732:Kcnn2 UTSW 18 45560349 missense possibly damaging 0.94
R4733:Kcnn2 UTSW 18 45560349 missense possibly damaging 0.94
R4801:Kcnn2 UTSW 18 45685267 splice site probably benign
R4844:Kcnn2 UTSW 18 45683120 missense possibly damaging 0.78
R4927:Kcnn2 UTSW 18 45559731 missense probably benign 0.01
R5011:Kcnn2 UTSW 18 45685285 missense possibly damaging 0.86
R5108:Kcnn2 UTSW 18 45592055 missense probably damaging 0.99
R5805:Kcnn2 UTSW 18 45683131 missense probably damaging 0.98
R5888:Kcnn2 UTSW 18 45592345 missense probably damaging 0.98
R5926:Kcnn2 UTSW 18 45685284 missense probably benign 0.01
R6552:Kcnn2 UTSW 18 45560098 missense probably benign 0.00
R6882:Kcnn2 UTSW 18 45559438 missense possibly damaging 0.53
R6999:Kcnn2 UTSW 18 45592377 missense probably damaging 0.99
R7324:Kcnn2 UTSW 18 45560071 missense probably benign
R7509:Kcnn2 UTSW 18 45683120 missense probably benign 0.32
R7667:Kcnn2 UTSW 18 45559438 missense possibly damaging 0.53
R8064:Kcnn2 UTSW 18 45559359 start codon destroyed probably benign 0.01
R8122:Kcnn2 UTSW 18 45676938 missense probably damaging 0.99
R8730:Kcnn2 UTSW 18 45592072 missense possibly damaging 0.75
R8768:Kcnn2 UTSW 18 45559435 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GGAATTCCTGCCTTGGAGTG -3'
(R):5'- AGCAGCAGGGACAGGTTATC -3'

Sequencing Primer
(F):5'- TGCCTTGGAGTGCCCTGAC -3'
(R):5'- CTGGCAATGCAGGTGTGAG -3'
Posted On2016-12-20