Incidental Mutation 'R5842:Pmvk'
ID450482
Institutional Source Beutler Lab
Gene Symbol Pmvk
Ensembl Gene ENSMUSG00000027952
Gene Namephosphomevalonate kinase
Synonyms
MMRRC Submission 043223-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R5842 (G1)
Quality Score146
Status Not validated
Chromosome3
Chromosomal Location89454541-89469013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89467620 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 108 (V108D)
Ref Sequence ENSEMBL: ENSMUSP00000139116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029564] [ENSMUST00000107410] [ENSMUST00000184515] [ENSMUST00000198440]
Predicted Effect probably damaging
Transcript: ENSMUST00000029564
AA Change: V129D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029564
Gene: ENSMUSG00000027952
AA Change: V129D

DomainStartEndE-ValueType
Pfam:P-mevalo_kinase 14 124 1.4e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107410
AA Change: V129D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103033
Gene: ENSMUSG00000027952
AA Change: V129D

DomainStartEndE-ValueType
Pfam:P-mevalo_kinase 14 129 9.3e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000184515
AA Change: V108D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139116
Gene: ENSMUSG00000027952
AA Change: V108D

DomainStartEndE-ValueType
Pfam:P-mevalo_kinase 5 108 3.9e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000198440
AA Change: V54D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143154
Gene: ENSMUSG00000027952
AA Change: V54D

DomainStartEndE-ValueType
Pfam:P-mevalo_kinase 1 54 5.6e-19 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a peroxisomal enzyme that is a member of the galactokinase, homoserine kinase, mevalonate kinase, and phosphomevalonate kinase (GHMP) family of ATP-dependent enzymes. The encoded protein catalyzes the conversion of mevalonate 5-phosphate to mevalonate 5-diphosphate, which is the fifth step in the mevalonate pathway of isoprenoid biosynthesis. Mutations in this gene are linked to certain types of porokeratosis including disseminated superficial porokeratosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 G A 3: 127,680,969 H462Y probably damaging Het
Atp12a T C 14: 56,378,290 I503T probably damaging Het
Bmp6 T A 13: 38,346,567 V212D probably damaging Het
Col7a1 A G 9: 108,965,815 D1479G unknown Het
Eea1 A G 10: 96,018,124 D548G probably damaging Het
Eif5a2 T C 3: 28,794,397 V135A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fstl5 T G 3: 76,322,283 N130K possibly damaging Het
Gatm T C 2: 122,603,627 I147V probably benign Het
Jakmip1 C T 5: 37,107,268 R418C probably damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Matn2 A T 15: 34,399,056 D363V probably damaging Het
Mov10 G A 3: 104,799,379 probably benign Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Nbas T C 12: 13,269,266 probably null Het
Nlgn1 A T 3: 26,133,743 probably null Het
Nnt T A 13: 119,394,747 I155F probably damaging Het
Olfr508 A G 7: 108,630,652 Y220C probably benign Het
Parp9 A G 16: 35,943,408 I19V possibly damaging Het
Pcdha11 T A 18: 37,011,284 S143T possibly damaging Het
Pdzph1 T G 17: 58,974,412 S292R possibly damaging Het
Ppil2 T C 16: 17,094,987 T26A possibly damaging Het
Rc3h2 T C 2: 37,378,371 T916A possibly damaging Het
Slc23a1 T A 18: 35,622,882 I393F probably damaging Het
Slc4a7 T A 14: 14,778,866 M925K probably damaging Het
Spag17 A G 3: 99,939,250 D30G possibly damaging Het
Syde2 A G 3: 145,999,020 I576V probably benign Het
Tgm2 C T 2: 158,143,081 R35H probably damaging Het
Tiam1 A G 16: 89,855,999 V745A probably benign Het
Timeless T C 10: 128,247,459 probably null Het
Tmem206 G T 1: 191,346,789 C223F probably damaging Het
Trp53tg5 T C 2: 164,471,369 K129E possibly damaging Het
Ttc6 T C 12: 57,737,016 Y1754H probably damaging Het
Ube4b G T 4: 149,331,430 T1069N probably benign Het
Ugcg C T 4: 59,219,545 S294L possibly damaging Het
Vgll2 T C 10: 52,025,292 L106P probably damaging Het
Vsig10l T A 7: 43,468,972 V798E probably benign Het
Wdr73 A T 7: 80,891,710 H361Q probably damaging Het
Xrcc3 A T 12: 111,804,530 F322I possibly damaging Het
Other mutations in Pmvk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Pmvk APN 3 89467583 missense probably damaging 1.00
R2090:Pmvk UTSW 3 89461882 missense possibly damaging 0.53
R3034:Pmvk UTSW 3 89468517 missense probably damaging 0.99
R5337:Pmvk UTSW 3 89468571 missense probably benign 0.36
R5469:Pmvk UTSW 3 89467682 critical splice donor site probably null
R5877:Pmvk UTSW 3 89464369 missense probably benign 0.25
R7657:Pmvk UTSW 3 89468851 missense possibly damaging 0.89
R8207:Pmvk UTSW 3 89468592 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCATGCTTCCTGGCAGGTG -3'
(R):5'- ATTCCTCAGGCCTCAGGTTC -3'

Sequencing Primer
(F):5'- ACCATTGCTCTGGCTTCAGTAG -3'
(R):5'- GGCCTCAGGTTCCCCTTTACAG -3'
Posted On2016-12-20