Incidental Mutation 'R5842:Jakmip1'
ID450491
Institutional Source Beutler Lab
Gene Symbol Jakmip1
Ensembl Gene ENSMUSG00000113373
Gene Name
SynonymsGababrbp, C330021K24Rik, Marlin-1, 5830437M04Rik
MMRRC Submission 043223-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.659) question?
Stock #R5842 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location37113784-37117473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 37107268 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 418 (R418C)
Ref Sequence ENSEMBL: ENSMUSP00000156188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043794] [ENSMUST00000121010] [ENSMUST00000137019] [ENSMUST00000174629] [ENSMUST00000232332]
Predicted Effect probably damaging
Transcript: ENSMUST00000043794
AA Change: R418C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038504
Gene: ENSMUSG00000063646
AA Change: R418C

DomainStartEndE-ValueType
coiled coil region 13 101 N/A INTRINSIC
coiled coil region 133 227 N/A INTRINSIC
coiled coil region 284 377 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
low complexity region 467 487 N/A INTRINSIC
coiled coil region 515 604 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121010
AA Change: R418C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113624
Gene: ENSMUSG00000063646
AA Change: R418C

DomainStartEndE-ValueType
coiled coil region 13 101 N/A INTRINSIC
coiled coil region 133 227 N/A INTRINSIC
coiled coil region 284 377 N/A INTRINSIC
Pfam:JAKMIP_CC3 415 612 3.3e-85 PFAM
coiled coil region 678 819 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137019
SMART Domains Protein: ENSMUSP00000122584
Gene: ENSMUSG00000063646

DomainStartEndE-ValueType
coiled coil region 13 101 N/A INTRINSIC
coiled coil region 133 227 N/A INTRINSIC
coiled coil region 284 330 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174629
SMART Domains Protein: ENSMUSP00000134288
Gene: ENSMUSG00000063646

DomainStartEndE-ValueType
coiled coil region 13 52 N/A INTRINSIC
coiled coil region 119 212 N/A INTRINSIC
low complexity region 282 302 N/A INTRINSIC
coiled coil region 330 422 N/A INTRINSIC
coiled coil region 493 634 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000232332
AA Change: R418C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in social deficits, stereotyped activity, abnormal postnatal vocalizations, reduced anxiety/increased impulsivity and glutamatergic NMDAR signaling deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 G A 3: 127,680,969 H462Y probably damaging Het
Atp12a T C 14: 56,378,290 I503T probably damaging Het
Bmp6 T A 13: 38,346,567 V212D probably damaging Het
Col7a1 A G 9: 108,965,815 D1479G unknown Het
Eea1 A G 10: 96,018,124 D548G probably damaging Het
Eif5a2 T C 3: 28,794,397 V135A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fstl5 T G 3: 76,322,283 N130K possibly damaging Het
Gatm T C 2: 122,603,627 I147V probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Matn2 A T 15: 34,399,056 D363V probably damaging Het
Mov10 G A 3: 104,799,379 probably benign Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Nbas T C 12: 13,269,266 probably null Het
Nlgn1 A T 3: 26,133,743 probably null Het
Nnt T A 13: 119,394,747 I155F probably damaging Het
Olfr508 A G 7: 108,630,652 Y220C probably benign Het
Parp9 A G 16: 35,943,408 I19V possibly damaging Het
Pcdha11 T A 18: 37,011,284 S143T possibly damaging Het
Pdzph1 T G 17: 58,974,412 S292R possibly damaging Het
Pmvk T A 3: 89,467,620 V108D probably damaging Het
Ppil2 T C 16: 17,094,987 T26A possibly damaging Het
Rc3h2 T C 2: 37,378,371 T916A possibly damaging Het
Slc23a1 T A 18: 35,622,882 I393F probably damaging Het
Slc4a7 T A 14: 14,778,866 M925K probably damaging Het
Spag17 A G 3: 99,939,250 D30G possibly damaging Het
Syde2 A G 3: 145,999,020 I576V probably benign Het
Tgm2 C T 2: 158,143,081 R35H probably damaging Het
Tiam1 A G 16: 89,855,999 V745A probably benign Het
Timeless T C 10: 128,247,459 probably null Het
Tmem206 G T 1: 191,346,789 C223F probably damaging Het
Trp53tg5 T C 2: 164,471,369 K129E possibly damaging Het
Ttc6 T C 12: 57,737,016 Y1754H probably damaging Het
Ube4b G T 4: 149,331,430 T1069N probably benign Het
Ugcg C T 4: 59,219,545 S294L possibly damaging Het
Vgll2 T C 10: 52,025,292 L106P probably damaging Het
Vsig10l T A 7: 43,468,972 V798E probably benign Het
Wdr73 A T 7: 80,891,710 H361Q probably damaging Het
Xrcc3 A T 12: 111,804,530 F322I possibly damaging Het
Other mutations in Jakmip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Jakmip1 APN 5 37085406 nonsense probably null
IGL01350:Jakmip1 APN 5 37085431 missense probably benign 0.01
IGL01613:Jakmip1 APN 5 37100768 missense probably damaging 1.00
IGL01875:Jakmip1 APN 5 37120980 missense probably damaging 0.99
IGL02006:Jakmip1 APN 5 37120987 missense probably damaging 0.99
IGL02225:Jakmip1 APN 5 37104856 missense probably damaging 0.99
IGL02389:Jakmip1 APN 5 37100843 nonsense probably null
R0036:Jakmip1 UTSW 5 37134304 missense probably null 0.38
R0194:Jakmip1 UTSW 5 37134283 missense possibly damaging 0.77
R0442:Jakmip1 UTSW 5 37135553 splice site probably null
R0555:Jakmip1 UTSW 5 37118873 missense probably damaging 0.99
R1053:Jakmip1 UTSW 5 37134249 missense possibly damaging 0.59
R1158:Jakmip1 UTSW 5 37091128 missense possibly damaging 0.94
R1470:Jakmip1 UTSW 5 37100838 missense probably damaging 1.00
R1470:Jakmip1 UTSW 5 37100838 missense probably damaging 1.00
R2339:Jakmip1 UTSW 5 37091199 missense probably benign 0.05
R2397:Jakmip1 UTSW 5 37100743 missense probably damaging 0.99
R2425:Jakmip1 UTSW 5 37141805 nonsense probably null
R2973:Jakmip1 UTSW 5 37091527 missense probably damaging 1.00
R4758:Jakmip1 UTSW 5 37128622 missense probably damaging 0.99
R4918:Jakmip1 UTSW 5 37091275 missense probably damaging 1.00
R5212:Jakmip1 UTSW 5 37104901 missense probably benign 0.05
R5926:Jakmip1 UTSW 5 37085280 unclassified probably benign
R6258:Jakmip1 UTSW 5 37141760 nonsense probably null
R6776:Jakmip1 UTSW 5 37187154 missense probably damaging 0.97
R6880:Jakmip1 UTSW 5 37105623 missense possibly damaging 0.95
R6961:Jakmip1 UTSW 5 37173353 missense probably damaging 0.98
R6982:Jakmip1 UTSW 5 37124941 missense probably damaging 1.00
R7109:Jakmip1 UTSW 5 37174765 nonsense probably null
R7173:Jakmip1 UTSW 5 37091364 missense probably damaging 1.00
R7293:Jakmip1 UTSW 5 37127473 missense probably benign 0.00
R7294:Jakmip1 UTSW 5 37117460 missense possibly damaging 0.65
R7361:Jakmip1 UTSW 5 37118804 missense probably damaging 1.00
R7384:Jakmip1 UTSW 5 37173207 missense possibly damaging 0.70
R7454:Jakmip1 UTSW 5 37175154 missense probably damaging 0.96
R7477:Jakmip1 UTSW 5 37173571 missense probably benign 0.00
R7579:Jakmip1 UTSW 5 37127458 missense possibly damaging 0.95
R7617:Jakmip1 UTSW 5 37171001 missense possibly damaging 0.85
R7651:Jakmip1 UTSW 5 37134273 missense probably damaging 0.97
R7702:Jakmip1 UTSW 5 37117497 missense probably damaging 1.00
R7822:Jakmip1 UTSW 5 37175180 missense probably damaging 0.99
R7888:Jakmip1 UTSW 5 37104864 missense probably damaging 1.00
R7971:Jakmip1 UTSW 5 37104864 missense probably damaging 1.00
R8015:Jakmip1 UTSW 5 37159765 missense unknown
R8039:Jakmip1 UTSW 5 37100772 missense probably damaging 1.00
R8044:Jakmip1 UTSW 5 37154644 missense unknown
R8070:Jakmip1 UTSW 5 37173287 missense probably benign 0.10
RF014:Jakmip1 UTSW 5 37174526 missense possibly damaging 0.59
T0722:Jakmip1 UTSW 5 37118903 missense probably damaging 1.00
Z1088:Jakmip1 UTSW 5 37120986 missense probably damaging 1.00
Z1177:Jakmip1 UTSW 5 37091583 missense probably damaging 1.00
Z1177:Jakmip1 UTSW 5 37175307 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATGAGATGGTCCATCAGGGTG -3'
(R):5'- CCATATCTGGGTCACATTACTGTG -3'

Sequencing Primer
(F):5'- AAGGACCTGAACGAGTGTCTTGTTAC -3'
(R):5'- CACATTACTGTGCCACAATGTATG -3'
Posted On2016-12-20