Incidental Mutation 'R5842:Mtpn'
ID450492
Institutional Source Beutler Lab
Gene Symbol Mtpn
Ensembl Gene ENSMUSG00000029840
Gene Namemyotrophin
SynonymsGcdp, V1, 5033418D15Rik
MMRRC Submission 043223-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.401) question?
Stock #R5842 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location35508906-35539888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 35512290 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 100 (D100N)
Ref Sequence ENSEMBL: ENSMUSP00000031866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031866]
PDB Structure
Solution NMR structure of V-1 bound to capping protein (CP) [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000031866
AA Change: D100N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000031866
Gene: ENSMUSG00000029840
AA Change: D100N

DomainStartEndE-ValueType
Blast:ANK 1 30 8e-9 BLAST
ANK 34 63 7.64e-6 SMART
ANK 67 96 1.14e-4 SMART
Meta Mutation Damage Score 0.1901 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transcript produced from this gene is bi-cistronic and can encode both myotrophin and leucine zipper protein 6. The myotrophin protein is associated with cardiac hypertrophy, where it is involved in the conversion of NFkappa B p50-p65 heterodimers to p50-p50 and p65-p65 homodimers. This protein also has a potential function in cerebellar morphogenesis, and it may be involved in the differentiation of cerebellar neurons, particularly of granule cells. A cryptic ORF at the 3' end of this transcript uses a novel internal ribosome entry site and a non-AUG translation initiation codon to produce leucine zipper protein 6, a 6.4 kDa tumor antigen that is associated with myeloproliferative disease. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 G A 3: 127,680,969 H462Y probably damaging Het
Atp12a T C 14: 56,378,290 I503T probably damaging Het
Bmp6 T A 13: 38,346,567 V212D probably damaging Het
Col7a1 A G 9: 108,965,815 D1479G unknown Het
Eea1 A G 10: 96,018,124 D548G probably damaging Het
Eif5a2 T C 3: 28,794,397 V135A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fstl5 T G 3: 76,322,283 N130K possibly damaging Het
Gatm T C 2: 122,603,627 I147V probably benign Het
Jakmip1 C T 5: 37,107,268 R418C probably damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Matn2 A T 15: 34,399,056 D363V probably damaging Het
Mov10 G A 3: 104,799,379 probably benign Het
Nbas T C 12: 13,269,266 probably null Het
Nlgn1 A T 3: 26,133,743 probably null Het
Nnt T A 13: 119,394,747 I155F probably damaging Het
Olfr508 A G 7: 108,630,652 Y220C probably benign Het
Parp9 A G 16: 35,943,408 I19V possibly damaging Het
Pcdha11 T A 18: 37,011,284 S143T possibly damaging Het
Pdzph1 T G 17: 58,974,412 S292R possibly damaging Het
Pmvk T A 3: 89,467,620 V108D probably damaging Het
Ppil2 T C 16: 17,094,987 T26A possibly damaging Het
Rc3h2 T C 2: 37,378,371 T916A possibly damaging Het
Slc23a1 T A 18: 35,622,882 I393F probably damaging Het
Slc4a7 T A 14: 14,778,866 M925K probably damaging Het
Spag17 A G 3: 99,939,250 D30G possibly damaging Het
Syde2 A G 3: 145,999,020 I576V probably benign Het
Tgm2 C T 2: 158,143,081 R35H probably damaging Het
Tiam1 A G 16: 89,855,999 V745A probably benign Het
Timeless T C 10: 128,247,459 probably null Het
Tmem206 G T 1: 191,346,789 C223F probably damaging Het
Trp53tg5 T C 2: 164,471,369 K129E possibly damaging Het
Ttc6 T C 12: 57,737,016 Y1754H probably damaging Het
Ube4b G T 4: 149,331,430 T1069N probably benign Het
Ugcg C T 4: 59,219,545 S294L possibly damaging Het
Vgll2 T C 10: 52,025,292 L106P probably damaging Het
Vsig10l T A 7: 43,468,972 V798E probably benign Het
Wdr73 A T 7: 80,891,710 H361Q probably damaging Het
Xrcc3 A T 12: 111,804,530 F322I possibly damaging Het
Other mutations in Mtpn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Mtpn APN 6 35522776 missense probably damaging 0.96
IGL00957:Mtpn APN 6 35539612 utr 5 prime probably benign
IGL03238:Mtpn APN 6 35522773 missense probably damaging 1.00
lamco UTSW 6 35522758 missense possibly damaging 0.65
R0972:Mtpn UTSW 6 35521976 missense probably null 0.78
R1311:Mtpn UTSW 6 35512250 missense possibly damaging 0.94
R1462:Mtpn UTSW 6 35522758 missense possibly damaging 0.65
R1462:Mtpn UTSW 6 35522758 missense possibly damaging 0.65
R3076:Mtpn UTSW 6 35521944 missense possibly damaging 0.67
R5297:Mtpn UTSW 6 35512290 missense probably benign 0.00
R5334:Mtpn UTSW 6 35512290 missense probably benign 0.00
R5336:Mtpn UTSW 6 35512290 missense probably benign 0.00
R5337:Mtpn UTSW 6 35512290 missense probably benign 0.00
R5512:Mtpn UTSW 6 35512290 missense probably benign 0.00
R5809:Mtpn UTSW 6 35512290 missense probably benign 0.00
R5841:Mtpn UTSW 6 35512290 missense probably benign 0.00
R5843:Mtpn UTSW 6 35512290 missense probably benign 0.00
R5844:Mtpn UTSW 6 35512290 missense probably benign 0.00
R5846:Mtpn UTSW 6 35512290 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCCTCTTAAAGTATTTAGCTGAAGAA -3'
(R):5'- CGGTTAAGTGAGCTCCAACTCT -3'

Sequencing Primer
(F):5'- AGCTGGCAGATAGAAAGTGAC -3'
(R):5'- TGAATCAGATGTAAGCTCTCAGC -3'
Posted On2016-12-20