Incidental Mutation 'R5842:Wdr73'
ID 450496
Institutional Source Beutler Lab
Gene Symbol Wdr73
Ensembl Gene ENSMUSG00000025722
Gene Name WD repeat domain 73
Synonyms 2410008B13Rik, 1200011I23Rik
MMRRC Submission 043223-MU
Accession Numbers

Genbank: NM_028026; MGI: 1919218

Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock # R5842 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 80890723-80901269 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 80891710 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 361 (H361Q)
Ref Sequence ENSEMBL: ENSMUSP00000026816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026816]
AlphaFold Q9CWR1
Predicted Effect probably damaging
Transcript: ENSMUST00000026816
AA Change: H361Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026816
Gene: ENSMUSG00000025722
AA Change: H361Q

DomainStartEndE-ValueType
WD40 67 112 8.52e1 SMART
Blast:WD40 162 204 3e-6 BLAST
Blast:WD40 208 254 3e-17 BLAST
WD40 263 304 2.57e0 SMART
WD40 314 364 8.91e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139990
Predicted Effect probably benign
Transcript: ENSMUST00000146402
SMART Domains Protein: ENSMUSP00000119974
Gene: ENSMUSG00000025722

DomainStartEndE-ValueType
Blast:WD40 66 111 3e-26 BLAST
Blast:WD40 182 228 4e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147589
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152518
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to contain multiple WD40 repeats. WD40 repeats are motifs that contain 40-60 amino acids, and usually end with Trp-Asp (WD). This protein is found in the cytoplasm during interphase, but accumulates at the spindle poles and astral microtubules during mitosis. Reduced expression of this gene results in abnormalities in the size and morphology of the nucleus. Mutations in this gene have been associated with Galloway-Mowat syndrome PMID: 25466283), which is a rare autosomal recessive disorder that affects both the central nervous system and kidneys. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 G A 3: 127,680,969 H462Y probably damaging Het
Atp12a T C 14: 56,378,290 I503T probably damaging Het
Bmp6 T A 13: 38,346,567 V212D probably damaging Het
Col7a1 A G 9: 108,965,815 D1479G unknown Het
Eea1 A G 10: 96,018,124 D548G probably damaging Het
Eif5a2 T C 3: 28,794,397 V135A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fstl5 T G 3: 76,322,283 N130K possibly damaging Het
Gatm T C 2: 122,603,627 I147V probably benign Het
Jakmip1 C T 5: 37,107,268 R418C probably damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Matn2 A T 15: 34,399,056 D363V probably damaging Het
Mov10 G A 3: 104,799,379 probably benign Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Nbas T C 12: 13,269,266 probably null Het
Nlgn1 A T 3: 26,133,743 probably null Het
Nnt T A 13: 119,394,747 I155F probably damaging Het
Olfr508 A G 7: 108,630,652 Y220C probably benign Het
Parp9 A G 16: 35,943,408 I19V possibly damaging Het
Pcdha11 T A 18: 37,011,284 S143T possibly damaging Het
Pdzph1 T G 17: 58,974,412 S292R possibly damaging Het
Pmvk T A 3: 89,467,620 V108D probably damaging Het
Ppil2 T C 16: 17,094,987 T26A possibly damaging Het
Rc3h2 T C 2: 37,378,371 T916A possibly damaging Het
Slc23a1 T A 18: 35,622,882 I393F probably damaging Het
Slc4a7 T A 14: 14,778,866 M925K probably damaging Het
Spag17 A G 3: 99,939,250 D30G possibly damaging Het
Syde2 A G 3: 145,999,020 I576V probably benign Het
Tgm2 C T 2: 158,143,081 R35H probably damaging Het
Tiam1 A G 16: 89,855,999 V745A probably benign Het
Timeless T C 10: 128,247,459 probably null Het
Tmem206 G T 1: 191,346,789 C223F probably damaging Het
Trp53tg5 T C 2: 164,471,369 K129E possibly damaging Het
Ttc6 T C 12: 57,737,016 Y1754H probably damaging Het
Ube4b G T 4: 149,331,430 T1069N probably benign Het
Ugcg C T 4: 59,219,545 S294L possibly damaging Het
Vgll2 T C 10: 52,025,292 L106P probably damaging Het
Vsig10l T A 7: 43,468,972 V798E probably benign Het
Xrcc3 A T 12: 111,804,530 F322I possibly damaging Het
Other mutations in Wdr73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00710:Wdr73 APN 7 80893663 missense probably benign 0.01
IGL02183:Wdr73 APN 7 80893760 missense probably damaging 1.00
IGL03253:Wdr73 APN 7 80897946 missense probably benign 0.00
3-1:Wdr73 UTSW 7 80897959 missense possibly damaging 0.91
R0469:Wdr73 UTSW 7 80897950 nonsense probably null
R0507:Wdr73 UTSW 7 80891846 missense possibly damaging 0.88
R0510:Wdr73 UTSW 7 80897950 nonsense probably null
R1349:Wdr73 UTSW 7 80893252 missense probably damaging 1.00
R1782:Wdr73 UTSW 7 80891778 missense probably damaging 1.00
R1917:Wdr73 UTSW 7 80893333 missense probably benign 0.17
R3085:Wdr73 UTSW 7 80901242 unclassified probably benign
R4478:Wdr73 UTSW 7 80893221 missense probably benign 0.06
R4479:Wdr73 UTSW 7 80893221 missense probably benign 0.06
R4480:Wdr73 UTSW 7 80893221 missense probably benign 0.06
R4910:Wdr73 UTSW 7 80891708 missense probably damaging 0.97
R4925:Wdr73 UTSW 7 80893195 missense probably benign 0.00
R5046:Wdr73 UTSW 7 80892425 unclassified probably benign
R5286:Wdr73 UTSW 7 80891809 missense probably benign 0.04
R6991:Wdr73 UTSW 7 80891856 missense probably benign 0.17
R7182:Wdr73 UTSW 7 80893678 missense possibly damaging 0.45
R7197:Wdr73 UTSW 7 80893198 missense probably benign 0.02
R7362:Wdr73 UTSW 7 80900703 missense probably damaging 1.00
R7771:Wdr73 UTSW 7 80893227 missense probably benign 0.13
R8558:Wdr73 UTSW 7 80898506 missense probably damaging 1.00
R8950:Wdr73 UTSW 7 80900383 missense probably benign 0.00
X0022:Wdr73 UTSW 7 80897951 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TAGAGGCAATGGTCGCTTCC -3'
(R):5'- GGGACAGTACAAATCTATGATGTCAC -3'

Sequencing Primer
(F):5'- AATGGTCGCTTCCAGCCATG -3'
(R):5'- CATCATGGGATGGAAAGAAAACCC -3'
Posted On 2016-12-20