Incidental Mutation 'R5842:Vgll2'
ID450499
Institutional Source Beutler Lab
Gene Symbol Vgll2
Ensembl Gene ENSMUSG00000049641
Gene Namevestigial like family member 2
SynonymsC130057C21Rik, Vito1, VITO-1, Vgl-2
MMRRC Submission 043223-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.818) question?
Stock #R5842 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location52022502-52028471 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52025292 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 106 (L106P)
Ref Sequence ENSEMBL: ENSMUSP00000124091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058347] [ENSMUST00000163017]
Predicted Effect probably damaging
Transcript: ENSMUST00000058347
AA Change: L106P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050273
Gene: ENSMUSG00000049641
AA Change: L106P

DomainStartEndE-ValueType
low complexity region 42 61 N/A INTRINSIC
Pfam:Vg_Tdu 78 110 7.6e-27 PFAM
low complexity region 192 204 N/A INTRINSIC
low complexity region 206 213 N/A INTRINSIC
low complexity region 245 262 N/A INTRINSIC
low complexity region 269 282 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163017
AA Change: L106P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124091
Gene: ENSMUSG00000049641
AA Change: L106P

DomainStartEndE-ValueType
low complexity region 42 61 N/A INTRINSIC
Pfam:Vg_Tdu 78 108 1.1e-23 PFAM
low complexity region 193 205 N/A INTRINSIC
low complexity region 207 214 N/A INTRINSIC
low complexity region 246 263 N/A INTRINSIC
low complexity region 270 283 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is a member of the Vestigial-like (Vgl) gene family and is upregulated during muscle differentiation. The product of this gene interacts with and modifies the DNA-binding properties of the transcription factor, TEF-1, and is important for muscle tissue development. Reduced expression of this gene leads to a reduction in the terminal differentiation of muscle cells. Alternate splicing results in multiple protein isoforms. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 G A 3: 127,680,969 H462Y probably damaging Het
Atp12a T C 14: 56,378,290 I503T probably damaging Het
Bmp6 T A 13: 38,346,567 V212D probably damaging Het
Col7a1 A G 9: 108,965,815 D1479G unknown Het
Eea1 A G 10: 96,018,124 D548G probably damaging Het
Eif5a2 T C 3: 28,794,397 V135A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fstl5 T G 3: 76,322,283 N130K possibly damaging Het
Gatm T C 2: 122,603,627 I147V probably benign Het
Jakmip1 C T 5: 37,107,268 R418C probably damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Matn2 A T 15: 34,399,056 D363V probably damaging Het
Mov10 G A 3: 104,799,379 probably benign Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Nbas T C 12: 13,269,266 probably null Het
Nlgn1 A T 3: 26,133,743 probably null Het
Nnt T A 13: 119,394,747 I155F probably damaging Het
Olfr508 A G 7: 108,630,652 Y220C probably benign Het
Parp9 A G 16: 35,943,408 I19V possibly damaging Het
Pcdha11 T A 18: 37,011,284 S143T possibly damaging Het
Pdzph1 T G 17: 58,974,412 S292R possibly damaging Het
Pmvk T A 3: 89,467,620 V108D probably damaging Het
Ppil2 T C 16: 17,094,987 T26A possibly damaging Het
Rc3h2 T C 2: 37,378,371 T916A possibly damaging Het
Slc23a1 T A 18: 35,622,882 I393F probably damaging Het
Slc4a7 T A 14: 14,778,866 M925K probably damaging Het
Spag17 A G 3: 99,939,250 D30G possibly damaging Het
Syde2 A G 3: 145,999,020 I576V probably benign Het
Tgm2 C T 2: 158,143,081 R35H probably damaging Het
Tiam1 A G 16: 89,855,999 V745A probably benign Het
Timeless T C 10: 128,247,459 probably null Het
Tmem206 G T 1: 191,346,789 C223F probably damaging Het
Trp53tg5 T C 2: 164,471,369 K129E possibly damaging Het
Ttc6 T C 12: 57,737,016 Y1754H probably damaging Het
Ube4b G T 4: 149,331,430 T1069N probably benign Het
Ugcg C T 4: 59,219,545 S294L possibly damaging Het
Vsig10l T A 7: 43,468,972 V798E probably benign Het
Wdr73 A T 7: 80,891,710 H361Q probably damaging Het
Xrcc3 A T 12: 111,804,530 F322I possibly damaging Het
Other mutations in Vgll2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02436:Vgll2 APN 10 52025222 nonsense probably null
R1796:Vgll2 UTSW 10 52025228 missense probably damaging 1.00
R5193:Vgll2 UTSW 10 52027992 missense possibly damaging 0.96
R5397:Vgll2 UTSW 10 52025166 missense probably damaging 1.00
R5614:Vgll2 UTSW 10 52025222 nonsense probably null
R5766:Vgll2 UTSW 10 52027563 missense probably damaging 1.00
R7063:Vgll2 UTSW 10 52027976 missense probably benign 0.00
R7272:Vgll2 UTSW 10 52027662 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GGGAGCTCCTCATTTTCCAACC -3'
(R):5'- GAAGAGTTTGCACCCTTTCCC -3'

Sequencing Primer
(F):5'- CCAACCCCAGCCAGTGTC -3'
(R):5'- GAGACCTCTTCCTGGTTCTTAC -3'
Posted On2016-12-20