Incidental Mutation 'R5842:Xrcc3'
ID450505
Institutional Source Beutler Lab
Gene Symbol Xrcc3
Ensembl Gene ENSMUSG00000021287
Gene NameX-ray repair complementing defective repair in Chinese hamster cells 3
Synonyms
MMRRC Submission 043223-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5842 (G1)
Quality Score158
Status Not validated
Chromosome12
Chromosomal Location111803192-111813873 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111804530 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 322 (F322I)
Ref Sequence ENSEMBL: ENSMUSP00000021715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021715] [ENSMUST00000084941] [ENSMUST00000122300] [ENSMUST00000127281] [ENSMUST00000134578]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021715
AA Change: F322I

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021715
Gene: ENSMUSG00000021287
AA Change: F322I

DomainStartEndE-ValueType
Pfam:Rad51 64 343 1.2e-25 PFAM
Pfam:AAA_25 70 261 2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084941
SMART Domains Protein: ENSMUSP00000082004
Gene: ENSMUSG00000021288

DomainStartEndE-ValueType
coiled coil region 86 156 N/A INTRINSIC
low complexity region 158 179 N/A INTRINSIC
low complexity region 188 206 N/A INTRINSIC
Pfam:TPR_10 212 253 3.1e-9 PFAM
TPR 255 288 3.81e-1 SMART
TPR 297 330 1.16e-5 SMART
TPR 339 372 4.77e-2 SMART
TPR 381 414 2.78e-3 SMART
TPR 464 497 4.93e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122300
SMART Domains Protein: ENSMUSP00000113997
Gene: ENSMUSG00000021288

DomainStartEndE-ValueType
Pfam:Rab5-bind 80 254 1e-68 PFAM
Pfam:TPR_10 212 253 8.4e-9 PFAM
TPR 255 288 3.81e-1 SMART
TPR 297 330 1.16e-5 SMART
TPR 339 372 4.77e-2 SMART
TPR 381 414 2.78e-3 SMART
TPR 464 497 2.99e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124064
Predicted Effect probably benign
Transcript: ENSMUST00000127281
SMART Domains Protein: ENSMUSP00000118040
Gene: ENSMUSG00000021287

DomainStartEndE-ValueType
Pfam:Rad51 64 193 4e-17 PFAM
Pfam:AAA_25 70 192 2.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134578
SMART Domains Protein: ENSMUSP00000120491
Gene: ENSMUSG00000021288

DomainStartEndE-ValueType
Pfam:TPR_1 1 25 1.9e-4 PFAM
Pfam:TPR_7 1 36 1.9e-4 PFAM
Pfam:TPR_10 75 112 7.8e-9 PFAM
Pfam:TPR_1 77 98 1.4e-4 PFAM
Pfam:TPR_7 78 129 1.7e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147203
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the RecA/Rad51-related protein family that participates in homologous recombination to maintain chromosome stability and repair DNA damage. This gene functionally complements Chinese hamster irs1SF, a repair-deficient mutant that exhibits hypersensitivity to a number of different DNA-damaging agents and is chromosomally unstable. Allelic variants in the human gene are associated with susceptibility to breast cancer and cutaneous malignant melanoma. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 G A 3: 127,680,969 H462Y probably damaging Het
Atp12a T C 14: 56,378,290 I503T probably damaging Het
Bmp6 T A 13: 38,346,567 V212D probably damaging Het
Col7a1 A G 9: 108,965,815 D1479G unknown Het
Eea1 A G 10: 96,018,124 D548G probably damaging Het
Eif5a2 T C 3: 28,794,397 V135A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fstl5 T G 3: 76,322,283 N130K possibly damaging Het
Gatm T C 2: 122,603,627 I147V probably benign Het
Jakmip1 C T 5: 37,107,268 R418C probably damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Matn2 A T 15: 34,399,056 D363V probably damaging Het
Mov10 G A 3: 104,799,379 probably benign Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Nbas T C 12: 13,269,266 probably null Het
Nlgn1 A T 3: 26,133,743 probably null Het
Nnt T A 13: 119,394,747 I155F probably damaging Het
Olfr508 A G 7: 108,630,652 Y220C probably benign Het
Parp9 A G 16: 35,943,408 I19V possibly damaging Het
Pcdha11 T A 18: 37,011,284 S143T possibly damaging Het
Pdzph1 T G 17: 58,974,412 S292R possibly damaging Het
Pmvk T A 3: 89,467,620 V108D probably damaging Het
Ppil2 T C 16: 17,094,987 T26A possibly damaging Het
Rc3h2 T C 2: 37,378,371 T916A possibly damaging Het
Slc23a1 T A 18: 35,622,882 I393F probably damaging Het
Slc4a7 T A 14: 14,778,866 M925K probably damaging Het
Spag17 A G 3: 99,939,250 D30G possibly damaging Het
Syde2 A G 3: 145,999,020 I576V probably benign Het
Tgm2 C T 2: 158,143,081 R35H probably damaging Het
Tiam1 A G 16: 89,855,999 V745A probably benign Het
Timeless T C 10: 128,247,459 probably null Het
Tmem206 G T 1: 191,346,789 C223F probably damaging Het
Trp53tg5 T C 2: 164,471,369 K129E possibly damaging Het
Ttc6 T C 12: 57,737,016 Y1754H probably damaging Het
Ube4b G T 4: 149,331,430 T1069N probably benign Het
Ugcg C T 4: 59,219,545 S294L possibly damaging Het
Vgll2 T C 10: 52,025,292 L106P probably damaging Het
Vsig10l T A 7: 43,468,972 V798E probably benign Het
Wdr73 A T 7: 80,891,710 H361Q probably damaging Het
Other mutations in Xrcc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0396:Xrcc3 UTSW 12 111809957 missense probably benign 0.00
R4534:Xrcc3 UTSW 12 111804532 missense probably damaging 0.99
R4535:Xrcc3 UTSW 12 111804532 missense probably damaging 0.99
R5406:Xrcc3 UTSW 12 111812111 missense probably damaging 0.99
R5762:Xrcc3 UTSW 12 111804610 missense probably damaging 0.97
R5937:Xrcc3 UTSW 12 111807972 missense probably null 0.51
R6985:Xrcc3 UTSW 12 111812096 missense probably damaging 0.98
R7011:Xrcc3 UTSW 12 111804535 missense probably damaging 1.00
R7560:Xrcc3 UTSW 12 111807902 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGATACTGACAGACTAACCG -3'
(R):5'- GACATGGTGGGCTGTACAAG -3'

Sequencing Primer
(F):5'- TGACAGACTAACCGTCACTGGG -3'
(R):5'- AGCACCAACACTCATTTTGTG -3'
Posted On2016-12-20