Incidental Mutation 'R5842:Ppil2'
ID450512
Institutional Source Beutler Lab
Gene Symbol Ppil2
Ensembl Gene ENSMUSG00000022771
Gene Namepeptidylprolyl isomerase (cyclophilin)-like 2
Synonyms
MMRRC Submission 043223-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5842 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location17086555-17111257 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17094987 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 26 (T26A)
Ref Sequence ENSEMBL: ENSMUSP00000156114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023455] [ENSMUST00000115721] [ENSMUST00000164458] [ENSMUST00000231245] [ENSMUST00000231451] [ENSMUST00000231712] [ENSMUST00000232481]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023455
AA Change: T204A

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000023455
Gene: ENSMUSG00000022771
AA Change: T204A

DomainStartEndE-ValueType
Ubox 42 101 2.53e-14 SMART
Pfam:Pro_isomerase 281 433 1.3e-50 PFAM
low complexity region 493 507 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115721
AA Change: T204A

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000111386
Gene: ENSMUSG00000022771
AA Change: T204A

DomainStartEndE-ValueType
Ubox 42 101 2.53e-14 SMART
Pfam:Pro_isomerase 281 433 3.7e-53 PFAM
low complexity region 493 507 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124030
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153927
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156521
Predicted Effect possibly damaging
Transcript: ENSMUST00000164458
AA Change: T204A

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131422
Gene: ENSMUSG00000022771
AA Change: T204A

DomainStartEndE-ValueType
Ubox 42 101 2.53e-14 SMART
Pfam:Pro_isomerase 281 433 1.3e-50 PFAM
low complexity region 493 507 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231287
Predicted Effect probably benign
Transcript: ENSMUST00000231451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231635
Predicted Effect possibly damaging
Transcript: ENSMUST00000231712
AA Change: T204A

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232397
Predicted Effect possibly damaging
Transcript: ENSMUST00000232481
AA Change: T26A

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cyclophilin family of peptidylprolyl isomerases. The cyclophilins are a highly conserved ubiquitous family, members of which play an important role in protein folding, immunosuppression by cyclosporin A, and infection of HIV-1 virions. This protein interacts with the proteinase inhibitor eglin c and is localized in the nucleus. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 G A 3: 127,680,969 H462Y probably damaging Het
Atp12a T C 14: 56,378,290 I503T probably damaging Het
Bmp6 T A 13: 38,346,567 V212D probably damaging Het
Col7a1 A G 9: 108,965,815 D1479G unknown Het
Eea1 A G 10: 96,018,124 D548G probably damaging Het
Eif5a2 T C 3: 28,794,397 V135A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fstl5 T G 3: 76,322,283 N130K possibly damaging Het
Gatm T C 2: 122,603,627 I147V probably benign Het
Jakmip1 C T 5: 37,107,268 R418C probably damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Matn2 A T 15: 34,399,056 D363V probably damaging Het
Mov10 G A 3: 104,799,379 probably benign Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Nbas T C 12: 13,269,266 probably null Het
Nlgn1 A T 3: 26,133,743 probably null Het
Nnt T A 13: 119,394,747 I155F probably damaging Het
Olfr508 A G 7: 108,630,652 Y220C probably benign Het
Parp9 A G 16: 35,943,408 I19V possibly damaging Het
Pcdha11 T A 18: 37,011,284 S143T possibly damaging Het
Pdzph1 T G 17: 58,974,412 S292R possibly damaging Het
Pmvk T A 3: 89,467,620 V108D probably damaging Het
Rc3h2 T C 2: 37,378,371 T916A possibly damaging Het
Slc23a1 T A 18: 35,622,882 I393F probably damaging Het
Slc4a7 T A 14: 14,778,866 M925K probably damaging Het
Spag17 A G 3: 99,939,250 D30G possibly damaging Het
Syde2 A G 3: 145,999,020 I576V probably benign Het
Tgm2 C T 2: 158,143,081 R35H probably damaging Het
Tiam1 A G 16: 89,855,999 V745A probably benign Het
Timeless T C 10: 128,247,459 probably null Het
Tmem206 G T 1: 191,346,789 C223F probably damaging Het
Trp53tg5 T C 2: 164,471,369 K129E possibly damaging Het
Ttc6 T C 12: 57,737,016 Y1754H probably damaging Het
Ube4b G T 4: 149,331,430 T1069N probably benign Het
Ugcg C T 4: 59,219,545 S294L possibly damaging Het
Vgll2 T C 10: 52,025,292 L106P probably damaging Het
Vsig10l T A 7: 43,468,972 V798E probably benign Het
Wdr73 A T 7: 80,891,710 H361Q probably damaging Het
Xrcc3 A T 12: 111,804,530 F322I possibly damaging Het
Other mutations in Ppil2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Ppil2 APN 16 17091212 missense probably damaging 1.00
IGL02392:Ppil2 APN 16 17088838 missense probably benign
IGL02559:Ppil2 APN 16 17109651 missense possibly damaging 0.80
IGL02708:Ppil2 APN 16 17106008 missense probably benign 0.03
IGL02724:Ppil2 APN 16 17103602 missense probably benign 0.08
zagnut UTSW 16 17096041 missense possibly damaging 0.62
R0592:Ppil2 UTSW 16 17107219 missense probably benign
R0975:Ppil2 UTSW 16 17107213 missense probably benign 0.00
R1258:Ppil2 UTSW 16 17106053 missense probably damaging 1.00
R1677:Ppil2 UTSW 16 17103610 missense probably damaging 1.00
R1728:Ppil2 UTSW 16 17089419 unclassified probably benign
R1739:Ppil2 UTSW 16 17089419 unclassified probably benign
R1784:Ppil2 UTSW 16 17089419 unclassified probably benign
R1853:Ppil2 UTSW 16 17107223 missense probably benign 0.00
R3608:Ppil2 UTSW 16 17092290 nonsense probably null
R3769:Ppil2 UTSW 16 17109668 missense probably benign 0.30
R4445:Ppil2 UTSW 16 17103600 nonsense probably null
R4518:Ppil2 UTSW 16 17096041 missense possibly damaging 0.62
R5066:Ppil2 UTSW 16 17109675 missense probably benign 0.03
R6013:Ppil2 UTSW 16 17100265 missense probably damaging 1.00
R6415:Ppil2 UTSW 16 17103574 critical splice donor site probably null
X0010:Ppil2 UTSW 16 17095037 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- CAGCAAATGCATCTAGGCCC -3'
(R):5'- AAGTCATGGCTGTGCTAAGACC -3'

Sequencing Primer
(F):5'- AAATGCATCTAGGCCCCGTGAG -3'
(R):5'- GCTGTGCTAAGACCAGCGAAC -3'
Posted On2016-12-20