Mutagenetix > Incidental Mutation

Incidental Mutation 'R5843:Agap1'

450522

Institutional Source

Beutler Lab

Gene Symbol

Agap1

Ensembl Gene

ENSMUSG00000055013

Gene Name

ArfGAP with GTPase domain, ankyrin repeat and PH domain 1

Synonyms

Ggap1, Centg2

MMRRC Submission

043224-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R5843 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

89454806-89897617 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 89609550 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 93 (T93A)

Ref Sequence

ENSEMBL: ENSMUSP00000140599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027521] [ENSMUST00000074945] [ENSMUST00000190096] [ENSMUST00000212721]

AlphaFold

Q8BXK8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027521
AA Change: T93A

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000027521
Gene: ENSMUSG00000055013
AA Change: T93A

Domain	Start	End	E-Value	Type
Pfam:Ras	73	231	1.1e-18	PFAM
low complexity region	269	289	N/A	INTRINSIC
PH	347	590	1.36e-15	SMART
ArfGap	609	729	4.58e-51	SMART
ANK	768	797	1.83e-3	SMART
ANK	801	832	1.33e2	SMART
low complexity region	840	852	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000074945

SMART Domains

Protein: ENSMUSP00000074478
Gene: ENSMUSG00000055013

Domain	Start	End	E-Value	Type
Pfam:Miro	73	181	5e-24	PFAM
Pfam:Ras	73	231	3e-19	PFAM
low complexity region	269	289	N/A	INTRINSIC
PH	347	537	7.93e-17	SMART
ArfGap	556	676	4.58e-51	SMART
ANK	715	744	1.83e-3	SMART
ANK	748	779	1.33e2	SMART
low complexity region	787	799	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000190096
AA Change: T93A

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000140599
Gene: ENSMUSG00000055013
AA Change: T93A

Domain	Start	End	E-Value	Type
Pfam:Miro	73	181	5e-24	PFAM
Pfam:Ras	73	231	3e-19	PFAM
low complexity region	269	289	N/A	INTRINSIC
PH	347	537	7.93e-17	SMART
ArfGap	556	676	4.58e-51	SMART
ANK	715	744	1.83e-3	SMART
ANK	748	779	1.33e2	SMART
low complexity region	787	799	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000212721
AA Change: T19A

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of an ADP-ribosylation factor GTPase-activating protein family involved in membrane trafficking and cytoskeleton dynamics. This gene functions as a direct regulator of the adaptor-related protein complex 3 on endosomes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp6v1h	T	A	1: 5,162,089		probably null	Het
Ccnk	T	C	12: 108,193,730	V157A	probably damaging	Het
Cdh10	T	C	15: 18,985,200	F317L	possibly damaging	Het
Chn1	A	G	2: 73,679,748	I139T	probably benign	Het
Creld2	A	T	15: 88,826,429	D349V	probably damaging	Het
Dnah3	TTCCTC	TTC	7: 119,951,021		probably benign	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Frem1	T	C	4: 82,936,052	D1660G	probably damaging	Het
Hipk3	A	C	2: 104,440,224	S470R	possibly damaging	Het
Hook2	T	A	8: 84,991,283	I37K	probably damaging	Het
Hpcal1	T	C	12: 17,791,199	F193L	probably benign	Het
Hps4	T	C	5: 112,349,430		probably null	Het
Iqgap1	T	C	7: 80,726,080	N1349S	probably benign	Het
Khk	A	G	5: 30,921,931	I6V	possibly damaging	Het
Kmt2d	G	A	15: 98,852,109		probably benign	Het
Lrch3	T	C	16: 32,998,526	V629A	probably damaging	Het
Mtpn	C	T	6: 35,512,290	D100N	probably benign	Het
Muc13	A	G	16: 33,806,051	Y320C	probably damaging	Het
Olfr10	A	T	11: 49,318,249	R234S	probably benign	Het
Olfr169	T	A	16: 19,566,583	Q100L	probably damaging	Het
Olfr203	T	A	16: 59,303,361	D69E	probably damaging	Het
Parpbp	A	G	10: 88,133,191	L131P	probably damaging	Het
Prl3a1	T	C	13: 27,270,110	W24R	probably damaging	Het
Ptprk	T	A	10: 28,493,064	N677K	probably damaging	Het
Rbm39	A	T	2: 156,162,873	D181E	possibly damaging	Het
Ros1	T	C	10: 52,166,197	T220A	possibly damaging	Het
Slc46a3	T	C	5: 147,886,211	I274V	probably benign	Het
Tas2r104	T	A	6: 131,684,975	N257I	probably damaging	Het
Timeless	A	G	10: 128,244,244		probably null	Het
Tmem63a	T	C	1: 180,972,833		probably null	Het
Traf5	T	C	1: 191,997,485	D535G	possibly damaging	Het
Trank1	C	T	9: 111,365,860	S984L	possibly damaging	Het
Trpm6	A	G	19: 18,856,175	T1573A	probably benign	Het
Ube3b	T	A	5: 114,412,299	I835N	probably damaging	Het
Wnt16	T	A	6: 22,290,948	I125N	probably damaging	Het
Xirp2	G	T	2: 67,476,785		probably benign	Het
Zc3h12c	G	T	9: 52,116,682	T460K	probably benign	Het
Zfp651	T	C	9: 121,767,339	F624S	possibly damaging	Het
Zfp865	C	A	7: 5,030,417	T467K	probably benign	Het
Zim1	A	G	7: 6,677,698	V322A	possibly damaging	Het

Other mutations in Agap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Agap1	APN	1	89663796	splice site	probably benign
IGL00310:Agap1	APN	1	89887670	missense	probably damaging	1.00
IGL01104:Agap1	APN	1	89726075	splice site	probably benign
IGL02227:Agap1	APN	1	89663775	missense	probably damaging	0.99
IGL02959:Agap1	APN	1	89843191	missense	possibly damaging	0.94
IGL03303:Agap1	APN	1	89665152	missense	probably damaging	1.00
K3955:Agap1	UTSW	1	89887604	missense	probably damaging	1.00
R0030:Agap1	UTSW	1	89888744	nonsense	probably null
R0234:Agap1	UTSW	1	89671212	missense	probably damaging	1.00
R0234:Agap1	UTSW	1	89671212	missense	probably damaging	1.00
R0400:Agap1	UTSW	1	89843250	splice site	probably benign
R1104:Agap1	UTSW	1	89789240	missense	probably damaging	0.99
R1160:Agap1	UTSW	1	89843154	missense	probably damaging	0.98
R1439:Agap1	UTSW	1	89843186	missense	probably damaging	1.00
R1454:Agap1	UTSW	1	89837806	splice site	probably null
R1644:Agap1	UTSW	1	89663730	missense	probably damaging	0.97
R1984:Agap1	UTSW	1	89766323	missense	probably benign
R2141:Agap1	UTSW	1	89837755	missense	probably damaging	0.99
R3966:Agap1	UTSW	1	89834461	missense	probably damaging	0.99
R4195:Agap1	UTSW	1	89834539	missense	probably damaging	0.99
R4669:Agap1	UTSW	1	89837806	splice site	probably null
R4951:Agap1	UTSW	1	89609503	missense	probably damaging	1.00
R5525:Agap1	UTSW	1	89743773	missense	possibly damaging	0.86
R5930:Agap1	UTSW	1	89843096	missense	probably damaging	1.00
R6030:Agap1	UTSW	1	89630434	missense	probably damaging	1.00
R6030:Agap1	UTSW	1	89630434	missense	probably damaging	1.00
R6879:Agap1	UTSW	1	89766455	missense	probably benign	0.25
R7027:Agap1	UTSW	1	89888722	missense	probably benign	0.00
R7207:Agap1	UTSW	1	89843099	missense	possibly damaging	0.91
R7268:Agap1	UTSW	1	89766348	missense	probably benign	0.02
R7289:Agap1	UTSW	1	89455431	start codon destroyed	probably null	0.01
R7689:Agap1	UTSW	1	89834466	missense	probably damaging	1.00
R7690:Agap1	UTSW	1	89843071	missense	probably benign	0.43
R7801:Agap1	UTSW	1	89630485	missense	probably damaging	1.00
R7849:Agap1	UTSW	1	89630419	missense	probably damaging	0.99
R8364:Agap1	UTSW	1	89887674	missense	probably damaging	1.00
R8491:Agap1	UTSW	1	89609572	missense	probably damaging	1.00
R9016:Agap1	UTSW	1	89766466	critical splice donor site	probably null
R9040:Agap1	UTSW	1	89743744	missense	probably damaging	0.98
R9254:Agap1	UTSW	1	89726019	missense	probably damaging	1.00
R9477:Agap1	UTSW	1	89837763	missense	probably benign
RF015:Agap1	UTSW	1	89634263	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACAGGAGCTGCTAATTTGGG -3'
(R):5'- ATGCGCTAGAACCCCAATGG -3'

Sequencing Primer
(F):5'- GGTTGACTCCATCTCCAATAGAAGG -3'
(R):5'- CCAATGGGAGGGAGCATATGC -3'

Posted On

2016-12-20