Incidental Mutation 'R5843:Chn1'
ID450528
Institutional Source Beutler Lab
Gene Symbol Chn1
Ensembl Gene ENSMUSG00000056486
Gene Namechimerin 1
Synonymsalpha2 chimaerin, 0610007I19Rik, 2900046J01Rik, 1700112L09Rik, 0710001E19Rik, alpha1 chimaerin, ARHGAP2
MMRRC Submission 043224-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.514) question?
Stock #R5843 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location73610660-73775346 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73679748 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 139 (I139T)
Ref Sequence ENSEMBL: ENSMUSP00000128847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112024] [ENSMUST00000135904] [ENSMUST00000139252] [ENSMUST00000166199] [ENSMUST00000180045]
Predicted Effect probably benign
Transcript: ENSMUST00000112024
AA Change: I139T

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000107655
Gene: ENSMUSG00000056486
AA Change: I139T

DomainStartEndE-ValueType
SH2 47 126 7.63e-15 SMART
C1 206 255 5.6e-14 SMART
RhoGAP 279 456 3.41e-74 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124450
Predicted Effect probably benign
Transcript: ENSMUST00000135904
AA Change: I87T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000115029
Gene: ENSMUSG00000056486
AA Change: I87T

DomainStartEndE-ValueType
SH2 1 74 1.84e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139252
SMART Domains Protein: ENSMUSP00000123312
Gene: ENSMUSG00000056486

DomainStartEndE-ValueType
Pfam:SH2 49 87 1.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166199
AA Change: I139T

PolyPhen 2 Score 0.395 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128847
Gene: ENSMUSG00000056486
AA Change: I139T

DomainStartEndE-ValueType
SH2 47 126 7.63e-15 SMART
RhoGAP 228 398 2.36e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180045
SMART Domains Protein: ENSMUSP00000137106
Gene: ENSMUSG00000056486

DomainStartEndE-ValueType
RhoGAP 30 207 3.41e-74 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229312
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229987
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes GTPase-activating protein for ras-related p21-rac and a phorbol ester receptor. It is predominantly expressed in neurons, and plays an important role in neuronal signal-transduction mechanisms. Mutations in this gene are associated with Duane's retraction syndrome 2 (DURS2). Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Apr 2011]
PHENOTYPE: Mice homologous for a null allele exhibit transient postnatal size reduction, abnormal gait and abnormal innervation of the spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,609,550 T93A probably damaging Het
Atp6v1h T A 1: 5,162,089 probably null Het
Ccnk T C 12: 108,193,730 V157A probably damaging Het
Cdh10 T C 15: 18,985,200 F317L possibly damaging Het
Creld2 A T 15: 88,826,429 D349V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Frem1 T C 4: 82,936,052 D1660G probably damaging Het
Hipk3 A C 2: 104,440,224 S470R possibly damaging Het
Hook2 T A 8: 84,991,283 I37K probably damaging Het
Hpcal1 T C 12: 17,791,199 F193L probably benign Het
Hps4 T C 5: 112,349,430 probably null Het
Iqgap1 T C 7: 80,726,080 N1349S probably benign Het
Khk A G 5: 30,921,931 I6V possibly damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrch3 T C 16: 32,998,526 V629A probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Muc13 A G 16: 33,806,051 Y320C probably damaging Het
Olfr10 A T 11: 49,318,249 R234S probably benign Het
Olfr169 T A 16: 19,566,583 Q100L probably damaging Het
Olfr203 T A 16: 59,303,361 D69E probably damaging Het
Parpbp A G 10: 88,133,191 L131P probably damaging Het
Prl3a1 T C 13: 27,270,110 W24R probably damaging Het
Ptprk T A 10: 28,493,064 N677K probably damaging Het
Rbm39 A T 2: 156,162,873 D181E possibly damaging Het
Ros1 T C 10: 52,166,197 T220A possibly damaging Het
Slc46a3 T C 5: 147,886,211 I274V probably benign Het
Tas2r104 T A 6: 131,684,975 N257I probably damaging Het
Timeless A G 10: 128,244,244 probably null Het
Tmem63a T C 1: 180,972,833 probably null Het
Traf5 T C 1: 191,997,485 D535G possibly damaging Het
Trank1 C T 9: 111,365,860 S984L possibly damaging Het
Trpm6 A G 19: 18,856,175 T1573A probably benign Het
Ube3b T A 5: 114,412,299 I835N probably damaging Het
Wnt16 T A 6: 22,290,948 I125N probably damaging Het
Xirp2 G T 2: 67,476,785 probably benign Het
Zc3h12c G T 9: 52,116,682 T460K probably benign Het
Zfp651 T C 9: 121,767,339 F624S possibly damaging Het
Zfp865 C A 7: 5,030,417 T467K probably benign Het
Zim1 A G 7: 6,677,698 V322A possibly damaging Het
Other mutations in Chn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Chn1 APN 2 73631752 missense probably damaging 1.00
P0043:Chn1 UTSW 2 73624165 missense probably damaging 0.98
R0107:Chn1 UTSW 2 73614684 missense probably damaging 1.00
R0410:Chn1 UTSW 2 73631750 nonsense probably null
R1496:Chn1 UTSW 2 73679607 splice site probably benign
R1935:Chn1 UTSW 2 73624901 missense probably damaging 1.00
R1939:Chn1 UTSW 2 73624901 missense probably damaging 1.00
R1940:Chn1 UTSW 2 73624901 missense probably damaging 1.00
R4457:Chn1 UTSW 2 73613083 missense probably damaging 0.96
R5005:Chn1 UTSW 2 73659786 missense possibly damaging 0.63
R6247:Chn1 UTSW 2 73707006 missense possibly damaging 0.95
R6564:Chn1 UTSW 2 73618041 missense probably damaging 1.00
R7371:Chn1 UTSW 2 73679890 missense probably damaging 1.00
R8046:Chn1 UTSW 2 73618019 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACACTGTGGGAACTTTCGG -3'
(R):5'- AGCATCTTTCCCATTTCATTGAGG -3'

Sequencing Primer
(F):5'- TGGGAACTTTCGGGCAGAG -3'
(R):5'- CCCATTTCATTGAGGCAGATTTG -3'
Posted On2016-12-20