Incidental Mutation 'R5843:Rbm39'
ID450530
Institutional Source Beutler Lab
Gene Symbol Rbm39
Ensembl Gene ENSMUSG00000027620
Gene NameRNA binding motif protein 39
SynonymsB330012G18Rik, Caper alpha, 1500012C14Rik, caper, Rnpc2, 2310040E03Rik
MMRRC Submission 043224-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5843 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location156147239-156180238 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 156162873 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 181 (D181E)
Ref Sequence ENSEMBL: ENSMUSP00000116820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029149] [ENSMUST00000109587] [ENSMUST00000126992] [ENSMUST00000142071] [ENSMUST00000146288] [ENSMUST00000146297] [ENSMUST00000153514] [ENSMUST00000155837]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029149
AA Change: D181E

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029149
Gene: ENSMUSG00000027620
AA Change: D181E

DomainStartEndE-ValueType
low complexity region 28 90 N/A INTRINSIC
low complexity region 117 136 N/A INTRINSIC
RRM 154 226 2.5e-15 SMART
RRM 251 324 1.39e-31 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
low complexity region 397 416 N/A INTRINSIC
RRM 419 498 9.44e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109587
AA Change: D181E

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105216
Gene: ENSMUSG00000027620
AA Change: D181E

DomainStartEndE-ValueType
low complexity region 28 90 N/A INTRINSIC
low complexity region 117 136 N/A INTRINSIC
RRM 154 226 2.5e-15 SMART
RRM 251 324 1.39e-31 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
low complexity region 403 422 N/A INTRINSIC
RRM 425 504 9.44e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000126992
AA Change: D180E

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116950
Gene: ENSMUSG00000027620
AA Change: D180E

DomainStartEndE-ValueType
low complexity region 28 90 N/A INTRINSIC
low complexity region 117 135 N/A INTRINSIC
RRM 153 225 2.5e-15 SMART
PDB:2JRS|A 239 273 9e-18 PDB
Blast:RRM 250 273 4e-9 BLAST
SCOP:d1l3ka1 250 273 9e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138381
Predicted Effect possibly damaging
Transcript: ENSMUST00000142071
AA Change: D181E

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116820
Gene: ENSMUSG00000027620
AA Change: D181E

DomainStartEndE-ValueType
low complexity region 28 90 N/A INTRINSIC
low complexity region 117 136 N/A INTRINSIC
RRM 154 226 2.5e-15 SMART
RRM 251 324 1.39e-31 SMART
Pfam:RBM39linker 339 404 3.8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146288
SMART Domains Protein: ENSMUSP00000114824
Gene: ENSMUSG00000027620

DomainStartEndE-ValueType
low complexity region 27 114 N/A INTRINSIC
PDB:2CQ4|A 115 156 2e-21 PDB
Blast:RRM 132 156 1e-9 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000146297
AA Change: D181E

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119298
Gene: ENSMUSG00000027620
AA Change: D181E

DomainStartEndE-ValueType
low complexity region 28 90 N/A INTRINSIC
low complexity region 117 136 N/A INTRINSIC
RRM 154 226 2.5e-15 SMART
RRM 251 324 1.39e-31 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
low complexity region 397 416 N/A INTRINSIC
RRM 419 498 9.44e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000148794
AA Change: D42E
SMART Domains Protein: ENSMUSP00000117462
Gene: ENSMUSG00000027620
AA Change: D42E

DomainStartEndE-ValueType
RRM 16 88 2.5e-15 SMART
RRM 113 164 2.45e-9 SMART
Pfam:RBM39linker 181 282 6.9e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150272
Predicted Effect probably benign
Transcript: ENSMUST00000153514
Predicted Effect probably benign
Transcript: ENSMUST00000155837
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the U2AF65 family of proteins. The encoded protein is found in the nucleus, where it co-localizes with core spliceosomal proteins. It has been shown to play a role in both steroid hormone receptor-mediated transcription and alternative splicing, and it is also a transcriptional coregulator of the viral oncoprotein v-Rel. Multiple transcript variants have been observed for this gene. A related pseudogene has been identified on chromosome X. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous disruption of this locus results in embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,609,550 T93A probably damaging Het
Atp6v1h T A 1: 5,162,089 probably null Het
Ccnk T C 12: 108,193,730 V157A probably damaging Het
Cdh10 T C 15: 18,985,200 F317L possibly damaging Het
Chn1 A G 2: 73,679,748 I139T probably benign Het
Creld2 A T 15: 88,826,429 D349V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Frem1 T C 4: 82,936,052 D1660G probably damaging Het
Hipk3 A C 2: 104,440,224 S470R possibly damaging Het
Hook2 T A 8: 84,991,283 I37K probably damaging Het
Hpcal1 T C 12: 17,791,199 F193L probably benign Het
Hps4 T C 5: 112,349,430 probably null Het
Iqgap1 T C 7: 80,726,080 N1349S probably benign Het
Khk A G 5: 30,921,931 I6V possibly damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrch3 T C 16: 32,998,526 V629A probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Muc13 A G 16: 33,806,051 Y320C probably damaging Het
Olfr10 A T 11: 49,318,249 R234S probably benign Het
Olfr169 T A 16: 19,566,583 Q100L probably damaging Het
Olfr203 T A 16: 59,303,361 D69E probably damaging Het
Parpbp A G 10: 88,133,191 L131P probably damaging Het
Prl3a1 T C 13: 27,270,110 W24R probably damaging Het
Ptprk T A 10: 28,493,064 N677K probably damaging Het
Ros1 T C 10: 52,166,197 T220A possibly damaging Het
Slc46a3 T C 5: 147,886,211 I274V probably benign Het
Tas2r104 T A 6: 131,684,975 N257I probably damaging Het
Timeless A G 10: 128,244,244 probably null Het
Tmem63a T C 1: 180,972,833 probably null Het
Traf5 T C 1: 191,997,485 D535G possibly damaging Het
Trank1 C T 9: 111,365,860 S984L possibly damaging Het
Trpm6 A G 19: 18,856,175 T1573A probably benign Het
Ube3b T A 5: 114,412,299 I835N probably damaging Het
Wnt16 T A 6: 22,290,948 I125N probably damaging Het
Xirp2 G T 2: 67,476,785 probably benign Het
Zc3h12c G T 9: 52,116,682 T460K probably benign Het
Zfp651 T C 9: 121,767,339 F624S possibly damaging Het
Zfp865 C A 7: 5,030,417 T467K probably benign Het
Zim1 A G 7: 6,677,698 V322A possibly damaging Het
Other mutations in Rbm39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Rbm39 APN 2 156162871 missense probably damaging 1.00
IGL01473:Rbm39 APN 2 156172979 nonsense probably null
R0040:Rbm39 UTSW 2 156148179 missense possibly damaging 0.90
R1564:Rbm39 UTSW 2 156154257 missense probably benign 0.01
R2888:Rbm39 UTSW 2 156167583 missense probably benign 0.01
R4872:Rbm39 UTSW 2 156177346 missense possibly damaging 0.94
R5124:Rbm39 UTSW 2 156159162 missense probably damaging 0.99
R5125:Rbm39 UTSW 2 156162865 missense probably damaging 0.99
R6714:Rbm39 UTSW 2 156161618 missense possibly damaging 0.82
R6820:Rbm39 UTSW 2 156179226 start codon destroyed probably null 0.66
R6970:Rbm39 UTSW 2 156167584 missense probably damaging 1.00
R8178:Rbm39 UTSW 2 156154275 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTCACTGATTTGCCATTTGG -3'
(R):5'- CAAATTCAGATCCACTTCTGCC -3'

Sequencing Primer
(F):5'- GTGTTAAGTGGTACAACATCCAGCTC -3'
(R):5'- CATTCTTGCAACTTTGGAGGCAGAG -3'
Posted On2016-12-20