Incidental Mutation 'R5843:Hps4'
ID450533
Institutional Source Beutler Lab
Gene Symbol Hps4
Ensembl Gene ENSMUSG00000042328
Gene NameHPS4, biogenesis of lysosomal organelles complex 3 subunit 2
SynonymsBLOC-3, 2010205O06Rik, C130020P05Rik
MMRRC Submission 043224-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.449) question?
Stock #R5843 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location112343083-112378414 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 112349430 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035279] [ENSMUST00000051117] [ENSMUST00000112359] [ENSMUST00000112359]
Predicted Effect probably null
Transcript: ENSMUST00000035279
SMART Domains Protein: ENSMUSP00000047920
Gene: ENSMUSG00000042328

DomainStartEndE-ValueType
low complexity region 171 180 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
low complexity region 514 529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051117
SMART Domains Protein: ENSMUSP00000049839
Gene: ENSMUSG00000051503

DomainStartEndE-ValueType
low complexity region 71 83 N/A INTRINSIC
coiled coil region 159 193 N/A INTRINSIC
Pfam:DUF4515 199 404 1.2e-79 PFAM
low complexity region 406 422 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112359
SMART Domains Protein: ENSMUSP00000107978
Gene: ENSMUSG00000042328

DomainStartEndE-ValueType
low complexity region 171 180 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
low complexity region 514 529 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112359
SMART Domains Protein: ENSMUSP00000107978
Gene: ENSMUSG00000042328

DomainStartEndE-ValueType
low complexity region 171 180 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
low complexity region 514 529 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133708
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176737
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein component of biogenesis of lysosome-related organelles complexes (BLOC). BLOC complexes are important for the formation of endosomal-lysosomal organelles such as melanosomes and platelet dense granules. Mutations in this gene result in subtype 4 of Hermansky-Pudlak syndrome, a form of albinism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygotes for a spontaneous null mutation exhibit hypopigmentation, prolonged bleeding associated with a platelet defect, reduced secretion of kidney lysosomal enzymes, and resistance to diet-induced atherosclerosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,609,550 T93A probably damaging Het
Atp6v1h T A 1: 5,162,089 probably null Het
Ccnk T C 12: 108,193,730 V157A probably damaging Het
Cdh10 T C 15: 18,985,200 F317L possibly damaging Het
Chn1 A G 2: 73,679,748 I139T probably benign Het
Creld2 A T 15: 88,826,429 D349V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Frem1 T C 4: 82,936,052 D1660G probably damaging Het
Hipk3 A C 2: 104,440,224 S470R possibly damaging Het
Hook2 T A 8: 84,991,283 I37K probably damaging Het
Hpcal1 T C 12: 17,791,199 F193L probably benign Het
Iqgap1 T C 7: 80,726,080 N1349S probably benign Het
Khk A G 5: 30,921,931 I6V possibly damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrch3 T C 16: 32,998,526 V629A probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Muc13 A G 16: 33,806,051 Y320C probably damaging Het
Olfr10 A T 11: 49,318,249 R234S probably benign Het
Olfr169 T A 16: 19,566,583 Q100L probably damaging Het
Olfr203 T A 16: 59,303,361 D69E probably damaging Het
Parpbp A G 10: 88,133,191 L131P probably damaging Het
Prl3a1 T C 13: 27,270,110 W24R probably damaging Het
Ptprk T A 10: 28,493,064 N677K probably damaging Het
Rbm39 A T 2: 156,162,873 D181E possibly damaging Het
Ros1 T C 10: 52,166,197 T220A possibly damaging Het
Slc46a3 T C 5: 147,886,211 I274V probably benign Het
Tas2r104 T A 6: 131,684,975 N257I probably damaging Het
Timeless A G 10: 128,244,244 probably null Het
Tmem63a T C 1: 180,972,833 probably null Het
Traf5 T C 1: 191,997,485 D535G possibly damaging Het
Trank1 C T 9: 111,365,860 S984L possibly damaging Het
Trpm6 A G 19: 18,856,175 T1573A probably benign Het
Ube3b T A 5: 114,412,299 I835N probably damaging Het
Wnt16 T A 6: 22,290,948 I125N probably damaging Het
Xirp2 G T 2: 67,476,785 probably benign Het
Zc3h12c G T 9: 52,116,682 T460K probably benign Het
Zfp651 T C 9: 121,767,339 F624S possibly damaging Het
Zfp865 C A 7: 5,030,417 T467K probably benign Het
Zim1 A G 7: 6,677,698 V322A possibly damaging Het
Other mutations in Hps4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01485:Hps4 APN 5 112364511 splice site probably benign
IGL02331:Hps4 APN 5 112369536 missense probably benign 0.03
IGL02410:Hps4 APN 5 112370227 missense probably benign 0.07
IGL02821:Hps4 APN 5 112375441 missense probably benign 0.02
R0748:Hps4 UTSW 5 112374914 missense probably damaging 1.00
R1487:Hps4 UTSW 5 112377999 nonsense probably null
R1891:Hps4 UTSW 5 112369556 splice site probably null
R2010:Hps4 UTSW 5 112369476 missense probably damaging 1.00
R2305:Hps4 UTSW 5 112346661 missense probably damaging 0.99
R3196:Hps4 UTSW 5 112364563 missense probably damaging 1.00
R4274:Hps4 UTSW 5 112375030 intron probably benign
R4878:Hps4 UTSW 5 112375368 missense probably benign 0.12
R4988:Hps4 UTSW 5 112378153 utr 3 prime probably benign
R5896:Hps4 UTSW 5 112369485 missense probably benign 0.02
R6318:Hps4 UTSW 5 112346629 missense probably damaging 1.00
R7381:Hps4 UTSW 5 112375458 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CTGGTAAAACATTGTCTGCTTCTCC -3'
(R):5'- AAATTCTGCCATGTTCAGAGCAGG -3'

Sequencing Primer
(F):5'- AAAACATTGTCTGCTTCTCCCACAG -3'
(R):5'- ATGTTCAGAGCAGGGCATCC -3'
Posted On2016-12-20