Incidental Mutation 'R5843:Ube3b'
ID 450534
Institutional Source Beutler Lab
Gene Symbol Ube3b
Ensembl Gene ENSMUSG00000029577
Gene Name ubiquitin protein ligase E3B
Synonyms
MMRRC Submission 043224-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5843 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 114518668-114559230 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 114550360 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 835 (I835N)
Ref Sequence ENSEMBL: ENSMUSP00000073652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]
AlphaFold Q9ES34
Predicted Effect probably damaging
Transcript: ENSMUST00000074002
AA Change: I835N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: I835N

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
low complexity region 470 488 N/A INTRINSIC
HECTc 697 1070 2.15e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130169
SMART Domains Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150630
Predicted Effect probably benign
Transcript: ENSMUST00000196651
SMART Domains Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
HECTc 122 495 1.1e-112 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,537,272 (GRCm39) T93A probably damaging Het
Atp6v1h T A 1: 5,232,312 (GRCm39) probably null Het
Ccnk T C 12: 108,159,989 (GRCm39) V157A probably damaging Het
Cdh10 T C 15: 18,985,286 (GRCm39) F317L possibly damaging Het
Chn1 A G 2: 73,510,092 (GRCm39) I139T probably benign Het
Creld2 A T 15: 88,710,632 (GRCm39) D349V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,550,244 (GRCm39) probably benign Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Frem1 T C 4: 82,854,289 (GRCm39) D1660G probably damaging Het
Hipk3 A C 2: 104,270,569 (GRCm39) S470R possibly damaging Het
Hook2 T A 8: 85,717,912 (GRCm39) I37K probably damaging Het
Hpcal1 T C 12: 17,841,200 (GRCm39) F193L probably benign Het
Hps4 T C 5: 112,497,296 (GRCm39) probably null Het
Iqgap1 T C 7: 80,375,828 (GRCm39) N1349S probably benign Het
Khk A G 5: 31,079,275 (GRCm39) I6V possibly damaging Het
Kmt2d G A 15: 98,749,990 (GRCm39) probably benign Het
Lrch3 T C 16: 32,818,896 (GRCm39) V629A probably damaging Het
Mtpn C T 6: 35,489,225 (GRCm39) D100N probably benign Het
Muc13 A G 16: 33,626,421 (GRCm39) Y320C probably damaging Het
Or2aj4 T A 16: 19,385,333 (GRCm39) Q100L probably damaging Het
Or2y1b A T 11: 49,209,076 (GRCm39) R234S probably benign Het
Or5ac21 T A 16: 59,123,724 (GRCm39) D69E probably damaging Het
Parpbp A G 10: 87,969,053 (GRCm39) L131P probably damaging Het
Prl3a1 T C 13: 27,454,093 (GRCm39) W24R probably damaging Het
Ptprk T A 10: 28,369,060 (GRCm39) N677K probably damaging Het
Rbm39 A T 2: 156,004,793 (GRCm39) D181E possibly damaging Het
Ros1 T C 10: 52,042,293 (GRCm39) T220A possibly damaging Het
Slc46a3 T C 5: 147,823,021 (GRCm39) I274V probably benign Het
Tas2r104 T A 6: 131,661,938 (GRCm39) N257I probably damaging Het
Timeless A G 10: 128,080,113 (GRCm39) probably null Het
Tmem63a T C 1: 180,800,398 (GRCm39) probably null Het
Traf5 T C 1: 191,729,446 (GRCm39) D535G possibly damaging Het
Trank1 C T 9: 111,194,928 (GRCm39) S984L possibly damaging Het
Trpm6 A G 19: 18,833,539 (GRCm39) T1573A probably benign Het
Wnt16 T A 6: 22,290,947 (GRCm39) I125N probably damaging Het
Xirp2 G T 2: 67,307,129 (GRCm39) probably benign Het
Zbtb47 T C 9: 121,596,405 (GRCm39) F624S possibly damaging Het
Zc3h12c G T 9: 52,027,982 (GRCm39) T460K probably benign Het
Zfp865 C A 7: 5,033,416 (GRCm39) T467K probably benign Het
Zim1 A G 7: 6,680,697 (GRCm39) V322A possibly damaging Het
Other mutations in Ube3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ube3b APN 5 114,553,348 (GRCm39) missense possibly damaging 0.93
IGL01154:Ube3b APN 5 114,544,313 (GRCm39) missense probably null 0.86
IGL02632:Ube3b APN 5 114,536,902 (GRCm39) missense probably benign
IGL02850:Ube3b APN 5 114,544,310 (GRCm39) missense probably damaging 1.00
IGL02878:Ube3b APN 5 114,542,778 (GRCm39) splice site probably null
IGL02881:Ube3b APN 5 114,550,945 (GRCm39) missense possibly damaging 0.78
R0003:Ube3b UTSW 5 114,536,912 (GRCm39) missense probably benign 0.17
R0071:Ube3b UTSW 5 114,557,558 (GRCm39) missense probably damaging 1.00
R0071:Ube3b UTSW 5 114,557,558 (GRCm39) missense probably damaging 1.00
R0076:Ube3b UTSW 5 114,546,278 (GRCm39) critical splice donor site probably null
R0076:Ube3b UTSW 5 114,546,278 (GRCm39) critical splice donor site probably null
R0111:Ube3b UTSW 5 114,528,437 (GRCm39) splice site probably benign
R0309:Ube3b UTSW 5 114,557,530 (GRCm39) splice site probably benign
R0718:Ube3b UTSW 5 114,540,616 (GRCm39) nonsense probably null
R1344:Ube3b UTSW 5 114,556,636 (GRCm39) missense probably damaging 1.00
R1350:Ube3b UTSW 5 114,544,198 (GRCm39) splice site probably null
R1418:Ube3b UTSW 5 114,556,636 (GRCm39) missense probably damaging 1.00
R1732:Ube3b UTSW 5 114,525,506 (GRCm39) missense probably benign 0.01
R1764:Ube3b UTSW 5 114,542,678 (GRCm39) missense possibly damaging 0.89
R1975:Ube3b UTSW 5 114,537,926 (GRCm39) missense possibly damaging 0.80
R2014:Ube3b UTSW 5 114,549,210 (GRCm39) missense probably damaging 1.00
R2015:Ube3b UTSW 5 114,549,210 (GRCm39) missense probably damaging 1.00
R2041:Ube3b UTSW 5 114,525,294 (GRCm39) missense probably damaging 0.99
R2074:Ube3b UTSW 5 114,553,316 (GRCm39) missense probably benign 0.14
R2202:Ube3b UTSW 5 114,527,135 (GRCm39) missense probably damaging 1.00
R2205:Ube3b UTSW 5 114,527,135 (GRCm39) missense probably damaging 1.00
R3826:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3829:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3830:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3927:Ube3b UTSW 5 114,553,741 (GRCm39) missense probably benign 0.03
R3974:Ube3b UTSW 5 114,550,491 (GRCm39) missense probably benign 0.05
R4049:Ube3b UTSW 5 114,550,931 (GRCm39) missense probably benign 0.09
R4096:Ube3b UTSW 5 114,531,147 (GRCm39) missense possibly damaging 0.65
R4261:Ube3b UTSW 5 114,536,489 (GRCm39) missense possibly damaging 0.80
R4415:Ube3b UTSW 5 114,550,505 (GRCm39) missense probably damaging 1.00
R4688:Ube3b UTSW 5 114,531,139 (GRCm39) missense probably benign 0.03
R4779:Ube3b UTSW 5 114,542,778 (GRCm39) splice site probably null
R4824:Ube3b UTSW 5 114,553,787 (GRCm39) splice site probably null
R4868:Ube3b UTSW 5 114,536,488 (GRCm39) missense probably benign 0.00
R4953:Ube3b UTSW 5 114,539,471 (GRCm39) missense probably benign 0.01
R5013:Ube3b UTSW 5 114,545,702 (GRCm39) missense probably damaging 1.00
R5057:Ube3b UTSW 5 114,544,318 (GRCm39) missense probably benign 0.01
R5117:Ube3b UTSW 5 114,557,692 (GRCm39) missense probably damaging 0.96
R5131:Ube3b UTSW 5 114,545,607 (GRCm39) missense probably damaging 1.00
R5498:Ube3b UTSW 5 114,556,635 (GRCm39) missense probably damaging 1.00
R5564:Ube3b UTSW 5 114,527,136 (GRCm39) missense probably damaging 1.00
R5572:Ube3b UTSW 5 114,544,240 (GRCm39) missense probably damaging 0.99
R5580:Ube3b UTSW 5 114,553,384 (GRCm39) missense probably benign
R5596:Ube3b UTSW 5 114,544,221 (GRCm39) splice site probably null
R5910:Ube3b UTSW 5 114,553,370 (GRCm39) missense possibly damaging 0.63
R6591:Ube3b UTSW 5 114,546,185 (GRCm39) missense probably benign 0.00
R6691:Ube3b UTSW 5 114,546,185 (GRCm39) missense probably benign 0.00
R7148:Ube3b UTSW 5 114,544,313 (GRCm39) missense probably damaging 0.97
R7334:Ube3b UTSW 5 114,553,742 (GRCm39) missense possibly damaging 0.64
R7438:Ube3b UTSW 5 114,556,687 (GRCm39) missense probably damaging 1.00
R7438:Ube3b UTSW 5 114,553,345 (GRCm39) missense possibly damaging 0.79
R7640:Ube3b UTSW 5 114,553,384 (GRCm39) missense probably benign
R7825:Ube3b UTSW 5 114,539,373 (GRCm39) missense probably damaging 1.00
R7958:Ube3b UTSW 5 114,539,484 (GRCm39) missense probably benign 0.05
R8025:Ube3b UTSW 5 114,546,270 (GRCm39) missense probably damaging 0.99
R8058:Ube3b UTSW 5 114,544,846 (GRCm39) missense possibly damaging 0.58
R8087:Ube3b UTSW 5 114,550,550 (GRCm39) critical splice donor site probably null
R8182:Ube3b UTSW 5 114,530,199 (GRCm39) missense possibly damaging 0.77
R8322:Ube3b UTSW 5 114,540,747 (GRCm39) missense probably benign 0.04
R8465:Ube3b UTSW 5 114,528,451 (GRCm39) missense probably damaging 1.00
R8682:Ube3b UTSW 5 114,550,351 (GRCm39) missense probably damaging 1.00
R8708:Ube3b UTSW 5 114,531,151 (GRCm39) missense probably benign 0.34
R8758:Ube3b UTSW 5 114,553,261 (GRCm39) critical splice acceptor site probably benign
R8784:Ube3b UTSW 5 114,526,800 (GRCm39) missense probably damaging 1.00
R9058:Ube3b UTSW 5 114,553,300 (GRCm39) missense probably benign 0.05
R9072:Ube3b UTSW 5 114,542,607 (GRCm39) missense probably damaging 0.98
R9116:Ube3b UTSW 5 114,542,837 (GRCm39) intron probably benign
R9537:Ube3b UTSW 5 114,525,245 (GRCm39) missense probably damaging 1.00
R9596:Ube3b UTSW 5 114,527,171 (GRCm39) missense probably damaging 1.00
R9632:Ube3b UTSW 5 114,553,370 (GRCm39) missense probably benign 0.00
R9710:Ube3b UTSW 5 114,553,370 (GRCm39) missense probably benign 0.00
X0017:Ube3b UTSW 5 114,553,646 (GRCm39) missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- CTGCATGTAGACTCCACCAGTG -3'
(R):5'- CTGACCCATGACGTCTTCATCG -3'

Sequencing Primer
(F):5'- ACTCCACCAGTGCCCGC -3'
(R):5'- TCGTAAGACAGCGTCAGC -3'
Posted On 2016-12-20