Incidental Mutation 'R5843:Slc46a3'
ID450535
Institutional Source Beutler Lab
Gene Symbol Slc46a3
Ensembl Gene ENSMUSG00000029650
Gene Namesolute carrier family 46, member 3
Synonyms
MMRRC Submission 043224-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5843 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location147878437-147894815 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 147886211 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 274 (I274V)
Ref Sequence ENSEMBL: ENSMUSP00000113879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031655] [ENSMUST00000118527]
Predicted Effect probably benign
Transcript: ENSMUST00000031655
AA Change: I274V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031655
Gene: ENSMUSG00000029650
AA Change: I274V

DomainStartEndE-ValueType
Pfam:MFS_1 8 400 4.3e-15 PFAM
transmembrane domain 411 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118527
AA Change: I274V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113879
Gene: ENSMUSG00000029650
AA Change: I274V

DomainStartEndE-ValueType
Pfam:MFS_1 8 400 5.5e-15 PFAM
transmembrane domain 411 433 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a transmembrane protein family that transports small molecules across membranes. The encoded protein has been found in lysosomal membranes, where it can transport catabolites from the lysosomes to the cytoplasm. This protein has been shown to be an effective transporter of the cytotoxic drug maytansine, which is used in antibody-based targeting of cancer cells. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,609,550 T93A probably damaging Het
Atp6v1h T A 1: 5,162,089 probably null Het
Ccnk T C 12: 108,193,730 V157A probably damaging Het
Cdh10 T C 15: 18,985,200 F317L possibly damaging Het
Chn1 A G 2: 73,679,748 I139T probably benign Het
Creld2 A T 15: 88,826,429 D349V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Frem1 T C 4: 82,936,052 D1660G probably damaging Het
Hipk3 A C 2: 104,440,224 S470R possibly damaging Het
Hook2 T A 8: 84,991,283 I37K probably damaging Het
Hpcal1 T C 12: 17,791,199 F193L probably benign Het
Hps4 T C 5: 112,349,430 probably null Het
Iqgap1 T C 7: 80,726,080 N1349S probably benign Het
Khk A G 5: 30,921,931 I6V possibly damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrch3 T C 16: 32,998,526 V629A probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Muc13 A G 16: 33,806,051 Y320C probably damaging Het
Olfr10 A T 11: 49,318,249 R234S probably benign Het
Olfr169 T A 16: 19,566,583 Q100L probably damaging Het
Olfr203 T A 16: 59,303,361 D69E probably damaging Het
Parpbp A G 10: 88,133,191 L131P probably damaging Het
Prl3a1 T C 13: 27,270,110 W24R probably damaging Het
Ptprk T A 10: 28,493,064 N677K probably damaging Het
Rbm39 A T 2: 156,162,873 D181E possibly damaging Het
Ros1 T C 10: 52,166,197 T220A possibly damaging Het
Tas2r104 T A 6: 131,684,975 N257I probably damaging Het
Timeless A G 10: 128,244,244 probably null Het
Tmem63a T C 1: 180,972,833 probably null Het
Traf5 T C 1: 191,997,485 D535G possibly damaging Het
Trank1 C T 9: 111,365,860 S984L possibly damaging Het
Trpm6 A G 19: 18,856,175 T1573A probably benign Het
Ube3b T A 5: 114,412,299 I835N probably damaging Het
Wnt16 T A 6: 22,290,948 I125N probably damaging Het
Xirp2 G T 2: 67,476,785 probably benign Het
Zc3h12c G T 9: 52,116,682 T460K probably benign Het
Zfp651 T C 9: 121,767,339 F624S possibly damaging Het
Zfp865 C A 7: 5,030,417 T467K probably benign Het
Zim1 A G 7: 6,677,698 V322A possibly damaging Het
Other mutations in Slc46a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01701:Slc46a3 APN 5 147886298 missense probably benign 0.00
IGL02158:Slc46a3 APN 5 147886234 missense probably damaging 1.00
IGL02821:Slc46a3 APN 5 147886012 missense probably benign 0.00
R1990:Slc46a3 UTSW 5 147886594 missense probably damaging 1.00
R2125:Slc46a3 UTSW 5 147879144 missense probably benign 0.05
R3904:Slc46a3 UTSW 5 147886454 missense probably benign 0.21
R4619:Slc46a3 UTSW 5 147886730 nonsense probably null
R5151:Slc46a3 UTSW 5 147886756 missense probably damaging 1.00
R5740:Slc46a3 UTSW 5 147879833 nonsense probably null
R5933:Slc46a3 UTSW 5 147893890 missense probably benign 0.03
R6453:Slc46a3 UTSW 5 147886390 missense possibly damaging 0.89
R6852:Slc46a3 UTSW 5 147886160 missense probably damaging 1.00
R6954:Slc46a3 UTSW 5 147886340 missense probably benign 0.01
Z1177:Slc46a3 UTSW 5 147886610 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CATCATTAGAGTGGTCCTGGTG -3'
(R):5'- TCCTCAATGATCCCATAAAGGAG -3'

Sequencing Primer
(F):5'- GTCATCCCCACCATGGTG -3'
(R):5'- AGGAGTCTTCATCTCAGATTGTGAC -3'
Posted On2016-12-20