Incidental Mutation 'R5843:Wnt16'
ID450536
Institutional Source Beutler Lab
Gene Symbol Wnt16
Ensembl Gene ENSMUSG00000029671
Gene Namewingless-type MMTV integration site family, member 16
SynonymsE130309I19Rik
MMRRC Submission 043224-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5843 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location22288227-22298522 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22290948 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 125 (I125N)
Ref Sequence ENSEMBL: ENSMUSP00000135016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031681] [ENSMUST00000128245] [ENSMUST00000148639]
Predicted Effect probably damaging
Transcript: ENSMUST00000031681
AA Change: I125N

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031681
Gene: ENSMUSG00000029671
AA Change: I125N

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
WNT1 48 364 1.13e-146 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128245
AA Change: I125N

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134822
Gene: ENSMUSG00000029671
AA Change: I125N

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
WNT1 48 225 1.04e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000148639
AA Change: I125N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135016
Gene: ENSMUSG00000029671
AA Change: I125N

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
WNT1 48 225 1.61e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176681
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It contains two transcript variants diverging at the 5' termini. These two variants are proposed to be the products of separate promoters and not to be splice variants from a single promoter. They are differentially expressed in normal tissues, one of which (variant 2) is expressed at significant levels only in the pancreas, whereas another one (variant 1) is expressed more ubiquitously with highest levels in adult kidney, placenta, brain, heart, and spleen. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased bone mineral density, cortical bone thickness and bone strength. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,609,550 T93A probably damaging Het
Atp6v1h T A 1: 5,162,089 probably null Het
Ccnk T C 12: 108,193,730 V157A probably damaging Het
Cdh10 T C 15: 18,985,200 F317L possibly damaging Het
Chn1 A G 2: 73,679,748 I139T probably benign Het
Creld2 A T 15: 88,826,429 D349V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Frem1 T C 4: 82,936,052 D1660G probably damaging Het
Hipk3 A C 2: 104,440,224 S470R possibly damaging Het
Hook2 T A 8: 84,991,283 I37K probably damaging Het
Hpcal1 T C 12: 17,791,199 F193L probably benign Het
Hps4 T C 5: 112,349,430 probably null Het
Iqgap1 T C 7: 80,726,080 N1349S probably benign Het
Khk A G 5: 30,921,931 I6V possibly damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrch3 T C 16: 32,998,526 V629A probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Muc13 A G 16: 33,806,051 Y320C probably damaging Het
Olfr10 A T 11: 49,318,249 R234S probably benign Het
Olfr169 T A 16: 19,566,583 Q100L probably damaging Het
Olfr203 T A 16: 59,303,361 D69E probably damaging Het
Parpbp A G 10: 88,133,191 L131P probably damaging Het
Prl3a1 T C 13: 27,270,110 W24R probably damaging Het
Ptprk T A 10: 28,493,064 N677K probably damaging Het
Rbm39 A T 2: 156,162,873 D181E possibly damaging Het
Ros1 T C 10: 52,166,197 T220A possibly damaging Het
Slc46a3 T C 5: 147,886,211 I274V probably benign Het
Tas2r104 T A 6: 131,684,975 N257I probably damaging Het
Timeless A G 10: 128,244,244 probably null Het
Tmem63a T C 1: 180,972,833 probably null Het
Traf5 T C 1: 191,997,485 D535G possibly damaging Het
Trank1 C T 9: 111,365,860 S984L possibly damaging Het
Trpm6 A G 19: 18,856,175 T1573A probably benign Het
Ube3b T A 5: 114,412,299 I835N probably damaging Het
Xirp2 G T 2: 67,476,785 probably benign Het
Zc3h12c G T 9: 52,116,682 T460K probably benign Het
Zfp651 T C 9: 121,767,339 F624S possibly damaging Het
Zfp865 C A 7: 5,030,417 T467K probably benign Het
Zim1 A G 7: 6,677,698 V322A possibly damaging Het
Other mutations in Wnt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Wnt16 APN 6 22291013 missense probably damaging 1.00
IGL01306:Wnt16 APN 6 22297935 missense probably damaging 0.99
IGL02297:Wnt16 APN 6 22297991 nonsense probably null
ANU23:Wnt16 UTSW 6 22297935 missense probably damaging 0.99
R0320:Wnt16 UTSW 6 22297993 missense possibly damaging 0.68
R1671:Wnt16 UTSW 6 22298179 missense probably damaging 1.00
R2342:Wnt16 UTSW 6 22288924 missense probably damaging 1.00
R3437:Wnt16 UTSW 6 22298134 missense probably damaging 0.99
R3786:Wnt16 UTSW 6 22298022 missense probably benign
R5301:Wnt16 UTSW 6 22297849 missense probably damaging 0.99
R5357:Wnt16 UTSW 6 22291232 intron probably benign
R5468:Wnt16 UTSW 6 22291161 missense probably benign 0.00
R6655:Wnt16 UTSW 6 22290966 missense probably damaging 1.00
R6731:Wnt16 UTSW 6 22297892 nonsense probably null
R6988:Wnt16 UTSW 6 22288511 missense probably damaging 1.00
R7437:Wnt16 UTSW 6 22288561 missense probably benign 0.17
R7904:Wnt16 UTSW 6 22297990 missense probably damaging 1.00
R7987:Wnt16 UTSW 6 22297990 missense probably damaging 1.00
R8071:Wnt16 UTSW 6 22288998 missense probably benign
Z1177:Wnt16 UTSW 6 22288588 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCATCCCTATGTGGAATACAGAAC -3'
(R):5'- AACTTTCTGCTGAACCACATGC -3'

Sequencing Primer
(F):5'- TGTGGAATACAGAACAATAATGCTGC -3'
(R):5'- TGAACCACATGCCGTACTGG -3'
Posted On2016-12-20