Incidental Mutation 'R5843:Tas2r104'
ID450538
Institutional Source Beutler Lab
Gene Symbol Tas2r104
Ensembl Gene ENSMUSG00000061977
Gene Nametaste receptor, type 2, member 104
SynonymsT2R04, mGR04, Tas2r4, mt2r45
MMRRC Submission 043224-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5843 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location131684836-131685744 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 131684975 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 257 (N257I)
Ref Sequence ENSEMBL: ENSMUSP00000072237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053652] [ENSMUST00000072404] [ENSMUST00000080619]
Predicted Effect probably benign
Transcript: ENSMUST00000053652
SMART Domains Protein: ENSMUSP00000058006
Gene: ENSMUSG00000051153

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 9.4e-109 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072404
AA Change: N257I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000072237
Gene: ENSMUSG00000061977
AA Change: N257I

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 8.3e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080619
SMART Domains Protein: ENSMUSP00000079453
Gene: ENSMUSG00000063478

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 8.1e-104 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,609,550 T93A probably damaging Het
Atp6v1h T A 1: 5,162,089 probably null Het
Ccnk T C 12: 108,193,730 V157A probably damaging Het
Cdh10 T C 15: 18,985,200 F317L possibly damaging Het
Chn1 A G 2: 73,679,748 I139T probably benign Het
Creld2 A T 15: 88,826,429 D349V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Frem1 T C 4: 82,936,052 D1660G probably damaging Het
Hipk3 A C 2: 104,440,224 S470R possibly damaging Het
Hook2 T A 8: 84,991,283 I37K probably damaging Het
Hpcal1 T C 12: 17,791,199 F193L probably benign Het
Hps4 T C 5: 112,349,430 probably null Het
Iqgap1 T C 7: 80,726,080 N1349S probably benign Het
Khk A G 5: 30,921,931 I6V possibly damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrch3 T C 16: 32,998,526 V629A probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Muc13 A G 16: 33,806,051 Y320C probably damaging Het
Olfr10 A T 11: 49,318,249 R234S probably benign Het
Olfr169 T A 16: 19,566,583 Q100L probably damaging Het
Olfr203 T A 16: 59,303,361 D69E probably damaging Het
Parpbp A G 10: 88,133,191 L131P probably damaging Het
Prl3a1 T C 13: 27,270,110 W24R probably damaging Het
Ptprk T A 10: 28,493,064 N677K probably damaging Het
Rbm39 A T 2: 156,162,873 D181E possibly damaging Het
Ros1 T C 10: 52,166,197 T220A possibly damaging Het
Slc46a3 T C 5: 147,886,211 I274V probably benign Het
Timeless A G 10: 128,244,244 probably null Het
Tmem63a T C 1: 180,972,833 probably null Het
Traf5 T C 1: 191,997,485 D535G possibly damaging Het
Trank1 C T 9: 111,365,860 S984L possibly damaging Het
Trpm6 A G 19: 18,856,175 T1573A probably benign Het
Ube3b T A 5: 114,412,299 I835N probably damaging Het
Wnt16 T A 6: 22,290,948 I125N probably damaging Het
Xirp2 G T 2: 67,476,785 probably benign Het
Zc3h12c G T 9: 52,116,682 T460K probably benign Het
Zfp651 T C 9: 121,767,339 F624S possibly damaging Het
Zfp865 C A 7: 5,030,417 T467K probably benign Het
Zim1 A G 7: 6,677,698 V322A possibly damaging Het
Other mutations in Tas2r104
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Tas2r104 APN 6 131685567 missense probably damaging 1.00
IGL01390:Tas2r104 APN 6 131685485 missense probably benign 0.13
IGL02751:Tas2r104 APN 6 131685144 missense probably damaging 1.00
PIT4585001:Tas2r104 UTSW 6 131685558 missense possibly damaging 0.50
R0218:Tas2r104 UTSW 6 131685092 missense probably damaging 1.00
R0453:Tas2r104 UTSW 6 131685341 missense probably benign 0.00
R0472:Tas2r104 UTSW 6 131685471 missense probably benign 0.06
R0614:Tas2r104 UTSW 6 131685202 missense probably damaging 1.00
R1290:Tas2r104 UTSW 6 131684845 nonsense probably null
R1480:Tas2r104 UTSW 6 131685294 missense probably benign 0.17
R1698:Tas2r104 UTSW 6 131685584 missense probably damaging 1.00
R2050:Tas2r104 UTSW 6 131685120 missense probably damaging 1.00
R2229:Tas2r104 UTSW 6 131685132 missense probably damaging 1.00
R3824:Tas2r104 UTSW 6 131685039 missense possibly damaging 0.55
R3852:Tas2r104 UTSW 6 131684925 missense probably benign 0.09
R4283:Tas2r104 UTSW 6 131685411 missense probably damaging 1.00
R4583:Tas2r104 UTSW 6 131685435 missense probably benign 0.00
R4710:Tas2r104 UTSW 6 131685444 missense probably damaging 0.96
R4954:Tas2r104 UTSW 6 131685005 missense probably damaging 0.99
R5559:Tas2r104 UTSW 6 131685131 missense probably damaging 1.00
R5765:Tas2r104 UTSW 6 131685273 missense probably benign
R7304:Tas2r104 UTSW 6 131685042 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCTGAACTGTGCCAGAACATTC -3'
(R):5'- CAATATGGGGCCCATTTCCC -3'

Sequencing Primer
(F):5'- GCCAGAACATTCATTTCTCTGTCAAG -3'
(R):5'- TTGTTAACCATTTCCCTTTGGAGAC -3'
Posted On2016-12-20