Incidental Mutation 'R5843:Zfp865'
ID450539
Institutional Source Beutler Lab
Gene Symbol Zfp865
Ensembl Gene ENSMUSG00000116184
Gene Name
Synonyms
MMRRC Submission 043224-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R5843 (G1)
Quality Score196
Status Not validated
Chromosome7
Chromosomal Location5034118-5035246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 5030417 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 467 (T467K)
Ref Sequence ENSEMBL: ENSMUSP00000082550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062428] [ENSMUST00000076251] [ENSMUST00000076791] [ENSMUST00000085427] [ENSMUST00000207050] [ENSMUST00000208728]
Predicted Effect probably benign
Transcript: ENSMUST00000062428
SMART Domains Protein: ENSMUSP00000051979
Gene: ENSMUSG00000043290

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
ZnF_C2H2 64 86 1.02e1 SMART
ZnF_C2H2 100 122 9.96e-1 SMART
ZnF_C2H2 128 150 6.67e-2 SMART
low complexity region 180 192 N/A INTRINSIC
ZnF_C2H2 195 217 4.11e-2 SMART
ZnF_C2H2 223 245 7.26e-3 SMART
ZnF_C2H2 251 273 3.21e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076251
AA Change: T467K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000075601
Gene: ENSMUSG00000074405
AA Change: T467K

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 62 82 N/A INTRINSIC
low complexity region 120 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
ZnF_C2H2 220 242 1.28e-3 SMART
ZnF_C2H2 248 270 5.5e-3 SMART
low complexity region 274 286 N/A INTRINSIC
low complexity region 294 324 N/A INTRINSIC
ZnF_C2H2 350 372 8.81e-2 SMART
ZnF_C2H2 378 400 6.08e-5 SMART
ZnF_C2H2 407 429 1.79e-2 SMART
ZnF_C2H2 439 461 1.92e-2 SMART
low complexity region 478 495 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
low complexity region 523 542 N/A INTRINSIC
ZnF_C2H2 546 568 4.47e-3 SMART
ZnF_C2H2 574 596 5.42e-2 SMART
ZnF_C2H2 602 624 1.72e-4 SMART
low complexity region 628 660 N/A INTRINSIC
ZnF_C2H2 664 686 5.34e-1 SMART
ZnF_C2H2 692 714 2.82e0 SMART
low complexity region 725 745 N/A INTRINSIC
low complexity region 750 770 N/A INTRINSIC
low complexity region 772 788 N/A INTRINSIC
ZnF_C2H2 791 813 1.64e-1 SMART
ZnF_C2H2 819 841 9.3e-1 SMART
ZnF_C2H2 847 869 2.95e-3 SMART
ZnF_C2H2 875 897 3.83e-2 SMART
ZnF_C2H2 903 925 2.05e-2 SMART
ZnF_C2H2 931 953 1.18e-2 SMART
ZnF_C2H2 959 981 1.36e-2 SMART
ZnF_C2H2 988 1010 5.06e-2 SMART
ZnF_C2H2 1016 1038 4.72e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076791
Predicted Effect probably benign
Transcript: ENSMUST00000085427
AA Change: T467K

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000082550
Gene: ENSMUSG00000074405
AA Change: T467K

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 62 82 N/A INTRINSIC
low complexity region 120 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
ZnF_C2H2 220 242 1.28e-3 SMART
ZnF_C2H2 248 270 5.5e-3 SMART
low complexity region 274 286 N/A INTRINSIC
low complexity region 294 324 N/A INTRINSIC
ZnF_C2H2 350 372 8.81e-2 SMART
ZnF_C2H2 378 400 6.08e-5 SMART
ZnF_C2H2 407 429 1.79e-2 SMART
ZnF_C2H2 439 461 1.92e-2 SMART
low complexity region 478 495 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
low complexity region 523 542 N/A INTRINSIC
ZnF_C2H2 546 568 4.47e-3 SMART
ZnF_C2H2 574 596 5.42e-2 SMART
ZnF_C2H2 602 624 1.72e-4 SMART
low complexity region 628 660 N/A INTRINSIC
ZnF_C2H2 664 686 5.34e-1 SMART
ZnF_C2H2 692 714 2.82e0 SMART
low complexity region 725 745 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207362
Predicted Effect probably benign
Transcript: ENSMUST00000208728
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,609,550 T93A probably damaging Het
Atp6v1h T A 1: 5,162,089 probably null Het
Ccnk T C 12: 108,193,730 V157A probably damaging Het
Cdh10 T C 15: 18,985,200 F317L possibly damaging Het
Chn1 A G 2: 73,679,748 I139T probably benign Het
Creld2 A T 15: 88,826,429 D349V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Frem1 T C 4: 82,936,052 D1660G probably damaging Het
Hipk3 A C 2: 104,440,224 S470R possibly damaging Het
Hook2 T A 8: 84,991,283 I37K probably damaging Het
Hpcal1 T C 12: 17,791,199 F193L probably benign Het
Hps4 T C 5: 112,349,430 probably null Het
Iqgap1 T C 7: 80,726,080 N1349S probably benign Het
Khk A G 5: 30,921,931 I6V possibly damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrch3 T C 16: 32,998,526 V629A probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Muc13 A G 16: 33,806,051 Y320C probably damaging Het
Olfr10 A T 11: 49,318,249 R234S probably benign Het
Olfr169 T A 16: 19,566,583 Q100L probably damaging Het
Olfr203 T A 16: 59,303,361 D69E probably damaging Het
Parpbp A G 10: 88,133,191 L131P probably damaging Het
Prl3a1 T C 13: 27,270,110 W24R probably damaging Het
Ptprk T A 10: 28,493,064 N677K probably damaging Het
Rbm39 A T 2: 156,162,873 D181E possibly damaging Het
Ros1 T C 10: 52,166,197 T220A possibly damaging Het
Slc46a3 T C 5: 147,886,211 I274V probably benign Het
Tas2r104 T A 6: 131,684,975 N257I probably damaging Het
Timeless A G 10: 128,244,244 probably null Het
Tmem63a T C 1: 180,972,833 probably null Het
Traf5 T C 1: 191,997,485 D535G possibly damaging Het
Trank1 C T 9: 111,365,860 S984L possibly damaging Het
Trpm6 A G 19: 18,856,175 T1573A probably benign Het
Ube3b T A 5: 114,412,299 I835N probably damaging Het
Wnt16 T A 6: 22,290,948 I125N probably damaging Het
Xirp2 G T 2: 67,476,785 probably benign Het
Zc3h12c G T 9: 52,116,682 T460K probably benign Het
Zfp651 T C 9: 121,767,339 F624S possibly damaging Het
Zim1 A G 7: 6,677,698 V322A possibly damaging Het
Other mutations in Zfp865
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01731:Zfp865 APN 7 5029876 missense probably benign
IGL02041:Zfp865 APN 7 5031373 missense probably benign
IGL03118:Zfp865 APN 7 5034645 intron probably benign
R0613:Zfp865 UTSW 7 5029091 missense possibly damaging 0.86
R0879:Zfp865 UTSW 7 5031343 missense probably benign
R0938:Zfp865 UTSW 7 5031404 missense possibly damaging 0.96
R1448:Zfp865 UTSW 7 5029279 nonsense probably null
R3955:Zfp865 UTSW 7 5032014 missense probably damaging 0.96
R4841:Zfp865 UTSW 7 5031641 missense probably damaging 1.00
R4842:Zfp865 UTSW 7 5031641 missense probably damaging 1.00
R5044:Zfp865 UTSW 7 5034669 intron probably benign
R5773:Zfp865 UTSW 7 5034694 intron probably benign
R5849:Zfp865 UTSW 7 5031087 missense probably damaging 1.00
R6393:Zfp865 UTSW 7 5030066 missense probably damaging 1.00
R6480:Zfp865 UTSW 7 5029783 missense probably damaging 0.98
R6681:Zfp865 UTSW 7 5029451 missense possibly damaging 0.86
R6880:Zfp865 UTSW 7 5030549 missense probably damaging 1.00
R7252:Zfp865 UTSW 7 5034417 intron probably benign
R7302:Zfp865 UTSW 7 5029253 missense possibly damaging 0.96
R7486:Zfp865 UTSW 7 5031260 missense possibly damaging 0.85
R7611:Zfp865 UTSW 7 5031131 missense probably damaging 0.99
R8058:Zfp865 UTSW 7 5030446 missense probably benign
R8327:Zfp865 UTSW 7 5031059 missense probably benign 0.08
R8728:Zfp865 UTSW 7 5031820 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCTGTGGCAAGGTCTTCCG -3'
(R):5'- TGCCACAGCAGAACGTCTTG -3'

Sequencing Primer
(F):5'- AAGGTCTTCCGCGATGC -3'
(R):5'- AGCAGAACGTCTTGCTGGG -3'
Posted On2016-12-20