Mutagenetix > Incidental Mutation

Incidental Mutation 'R5843:Eml2'

450541

Institutional Source

Beutler Lab

Gene Symbol

Eml2

Ensembl Gene

ENSMUSG00000040811

Gene Name

echinoderm microtubule associated protein like 2

Synonyms

1600029N02Rik

MMRRC Submission

043224-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5843 (G1)

Quality Score

215

Status

Not validated

Chromosome

Chromosomal Location

19176421-19206482 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 19201163 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 432 (V432I)

Ref Sequence

ENSEMBL: ENSMUSP00000112447 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048502] [ENSMUST00000117338] [ENSMUST00000120595] [ENSMUST00000148246]

AlphaFold

Q7TNG5

Predicted Effect

probably damaging
Transcript: ENSMUST00000048502
AA Change: V451I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000037654
Gene: ENSMUSG00000040811
AA Change: V451I

Domain	Start	End	E-Value	Type
Pfam:HELP	17	65	4.6e-14	PFAM
WD40	113	162	8.36e-2	SMART
WD40	165	210	9.21e0	SMART
WD40	213	252	7.99e-1	SMART
WD40	258	298	3.7e0	SMART
WD40	301	341	3.58e-1	SMART
WD40	385	424	5.52e-2	SMART
WD40	427	465	1.1e1	SMART
WD40	468	507	4.95e-4	SMART
WD40	514	553	4.62e-4	SMART
WD40	579	620	4.75e1	SMART
WD40	626	666	2.67e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000117338
AA Change: V624I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000112491
Gene: ENSMUSG00000040811
AA Change: V624I

Domain	Start	End	E-Value	Type
low complexity region	2	32	N/A	INTRINSIC
coiled coil region	59	106	N/A	INTRINSIC
low complexity region	183	191	N/A	INTRINSIC
Pfam:HELP	211	285	3.5e-29	PFAM
WD40	286	335	5.5e-4	SMART
WD40	338	383	5.8e-2	SMART
WD40	386	425	5.2e-3	SMART
WD40	431	471	2.4e-2	SMART
WD40	474	514	2.3e-3	SMART
WD40	558	597	3.6e-4	SMART
WD40	600	638	7.1e-2	SMART
WD40	641	680	3.1e-6	SMART
WD40	687	726	3.1e-6	SMART
WD40	752	793	3e-1	SMART
WD40	799	839	1.7e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000120595
AA Change: V432I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112447
Gene: ENSMUSG00000040811
AA Change: V432I

Domain	Start	End	E-Value	Type
WD40	94	154	2.48e0	SMART
WD40	157	196	7.99e-1	SMART
WD40	202	242	3.7e0	SMART
WD40	245	285	3.58e-1	SMART
WD40	329	368	5.52e-2	SMART
WD40	371	409	1.1e1	SMART
WD40	412	451	4.95e-4	SMART
WD40	458	497	4.62e-4	SMART
WD40	523	564	4.75e1	SMART
WD40	570	610	2.67e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000148246

SMART Domains

Protein: ENSMUSP00000115466
Gene: ENSMUSG00000040811

Domain	Start	End	E-Value	Type
WD40	94	143	8.36e-2	SMART
WD40	146	191	9.21e0	SMART
WD40	194	233	7.99e-1	SMART
WD40	239	279	3.7e0	SMART
WD40	282	322	3.58e-1	SMART
WD40	366	405	5.52e-2	SMART

Meta Mutation Damage Score

0.2533

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agap1	A	G	1: 89,609,550	T93A	probably damaging	Het
Atp6v1h	T	A	1: 5,162,089		probably null	Het
Ccnk	T	C	12: 108,193,730	V157A	probably damaging	Het
Cdh10	T	C	15: 18,985,200	F317L	possibly damaging	Het
Chn1	A	G	2: 73,679,748	I139T	probably benign	Het
Creld2	A	T	15: 88,826,429	D349V	probably damaging	Het
Dnah3	TTCCTC	TTC	7: 119,951,021		probably benign	Het
Frem1	T	C	4: 82,936,052	D1660G	probably damaging	Het
Hipk3	A	C	2: 104,440,224	S470R	possibly damaging	Het
Hook2	T	A	8: 84,991,283	I37K	probably damaging	Het
Hpcal1	T	C	12: 17,791,199	F193L	probably benign	Het
Hps4	T	C	5: 112,349,430		probably null	Het
Iqgap1	T	C	7: 80,726,080	N1349S	probably benign	Het
Khk	A	G	5: 30,921,931	I6V	possibly damaging	Het
Kmt2d	G	A	15: 98,852,109		probably benign	Het
Lrch3	T	C	16: 32,998,526	V629A	probably damaging	Het
Mtpn	C	T	6: 35,512,290	D100N	probably benign	Het
Muc13	A	G	16: 33,806,051	Y320C	probably damaging	Het
Olfr10	A	T	11: 49,318,249	R234S	probably benign	Het
Olfr169	T	A	16: 19,566,583	Q100L	probably damaging	Het
Olfr203	T	A	16: 59,303,361	D69E	probably damaging	Het
Parpbp	A	G	10: 88,133,191	L131P	probably damaging	Het
Prl3a1	T	C	13: 27,270,110	W24R	probably damaging	Het
Ptprk	T	A	10: 28,493,064	N677K	probably damaging	Het
Rbm39	A	T	2: 156,162,873	D181E	possibly damaging	Het
Ros1	T	C	10: 52,166,197	T220A	possibly damaging	Het
Slc46a3	T	C	5: 147,886,211	I274V	probably benign	Het
Tas2r104	T	A	6: 131,684,975	N257I	probably damaging	Het
Timeless	A	G	10: 128,244,244		probably null	Het
Tmem63a	T	C	1: 180,972,833		probably null	Het
Traf5	T	C	1: 191,997,485	D535G	possibly damaging	Het
Trank1	C	T	9: 111,365,860	S984L	possibly damaging	Het
Trpm6	A	G	19: 18,856,175	T1573A	probably benign	Het
Ube3b	T	A	5: 114,412,299	I835N	probably damaging	Het
Wnt16	T	A	6: 22,290,948	I125N	probably damaging	Het
Xirp2	G	T	2: 67,476,785		probably benign	Het
Zc3h12c	G	T	9: 52,116,682	T460K	probably benign	Het
Zfp651	T	C	9: 121,767,339	F624S	possibly damaging	Het
Zfp865	C	A	7: 5,030,417	T467K	probably benign	Het
Zim1	A	G	7: 6,677,698	V322A	possibly damaging	Het

Other mutations in Eml2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00690:Eml2	APN	7	19206143	missense	probably damaging	1.00
IGL00786:Eml2	APN	7	19202582	missense	probably damaging	1.00
IGL01084:Eml2	APN	7	19190738	nonsense	probably null
IGL01132:Eml2	APN	7	19200539	missense	probably damaging	1.00
IGL01678:Eml2	APN	7	19186122	missense	probably benign	0.38
IGL01800:Eml2	APN	7	19201197	intron	probably benign
IGL02517:Eml2	APN	7	19206130	missense	probably damaging	1.00
IGL02607:Eml2	APN	7	19206111	missense	probably damaging	1.00
IGL02676:Eml2	APN	7	19184921	nonsense	probably null
IGL03082:Eml2	APN	7	19201877	missense	probably damaging	1.00
puffery	UTSW	7	19201163	missense	probably damaging	1.00
R0628_Eml2_697	UTSW	7	19201554	splice site	probably benign
R0040:Eml2	UTSW	7	19196614	missense	possibly damaging	0.48
R0135:Eml2	UTSW	7	19203952	missense	probably damaging	1.00
R0240:Eml2	UTSW	7	19184872	nonsense	probably null
R0240:Eml2	UTSW	7	19184872	nonsense	probably null
R0362:Eml2	UTSW	7	19190806	splice site	probably null
R0387:Eml2	UTSW	7	19182259	splice site	probably null
R0432:Eml2	UTSW	7	19179531	nonsense	probably null
R0614:Eml2	UTSW	7	19202591	missense	probably damaging	1.00
R0628:Eml2	UTSW	7	19201554	splice site	probably benign
R1078:Eml2	UTSW	7	19179762	missense	probably benign	0.24
R1531:Eml2	UTSW	7	19196254	missense	probably damaging	1.00
R1856:Eml2	UTSW	7	19194061	missense	probably damaging	0.97
R1864:Eml2	UTSW	7	19201878	missense	probably damaging	1.00
R1937:Eml2	UTSW	7	19203964	missense	possibly damaging	0.68
R2032:Eml2	UTSW	7	19202555	missense	probably benign	0.03
R2185:Eml2	UTSW	7	19194028	missense	probably damaging	1.00
R2419:Eml2	UTSW	7	19176695	unclassified	probably benign
R3821:Eml2	UTSW	7	19202986	missense	possibly damaging	0.94
R4199:Eml2	UTSW	7	19179439	missense	probably benign	0.00
R4411:Eml2	UTSW	7	19182401	critical splice donor site	probably null
R4497:Eml2	UTSW	7	19179350	missense	probably damaging	1.00
R4885:Eml2	UTSW	7	19204010	missense	probably benign	0.05
R4912:Eml2	UTSW	7	19193999	splice site	probably null
R5028:Eml2	UTSW	7	19179447	critical splice donor site	probably null
R5192:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5196:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5373:Eml2	UTSW	7	19179263	missense	possibly damaging	0.92
R5718:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5719:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5720:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5727:Eml2	UTSW	7	19190760	missense	probably damaging	0.99
R5841:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5842:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5844:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6014:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6015:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6017:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6073:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6075:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6126:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6128:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6129:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6189:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6190:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6258:Eml2	UTSW	7	19179364	splice site	probably null
R6273:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6289:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6376:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6378:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6381:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6384:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6394:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6435:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6436:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6437:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6476:Eml2	UTSW	7	19196311	missense	probably benign	0.26
R6550:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6551:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6552:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6554:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6572:Eml2	UTSW	7	19196614	missense	possibly damaging	0.48
R6598:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6599:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6704:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6705:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6709:Eml2	UTSW	7	19206211	makesense	probably null
R6730:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6734:Eml2	UTSW	7	19200507	missense	probably benign	0.35
R6742:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6769:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6770:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6864:Eml2	UTSW	7	19196281	missense	probably damaging	0.99
R6878:Eml2	UTSW	7	19200612	missense	probably benign	0.08
R7045:Eml2	UTSW	7	19201579	missense	probably damaging	1.00
R7260:Eml2	UTSW	7	19200590	missense	probably benign	0.45
R7478:Eml2	UTSW	7	19206141	nonsense	probably null
R7706:Eml2	UTSW	7	19186110	missense	possibly damaging	0.79
R7811:Eml2	UTSW	7	19186122	missense	probably benign	0.38
R8084:Eml2	UTSW	7	19181224	critical splice donor site	probably null
R8337:Eml2	UTSW	7	19196236	missense	possibly damaging	0.84
R8414:Eml2	UTSW	7	19179295	missense	probably damaging	1.00
R8868:Eml2	UTSW	7	19194063	missense	probably benign	0.03
R8934:Eml2	UTSW	7	19179813	missense	probably damaging	0.99
R9110:Eml2	UTSW	7	19191695	missense	probably benign	0.07
R9131:Eml2	UTSW	7	19184826	missense
R9144:Eml2	UTSW	7	19201639	missense	possibly damaging	0.75
R9261:Eml2	UTSW	7	19179818	missense	probably benign	0.45
R9285:Eml2	UTSW	7	19191643	missense	probably damaging	0.98
R9767:Eml2	UTSW	7	19186158	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGAAATGGGGATGGCTTCTG -3'
(R):5'- TGTGTGACAGGCTGAGATGAAC -3'

Sequencing Primer
(F):5'- CTTCTGGTGGTTTCTGTAAGGCATC -3'
(R):5'- GGATTGAAGCAGCAGGTT -3'

Posted On

2016-12-20