Incidental Mutation 'R5843:Iqgap1'
ID450542
Institutional Source Beutler Lab
Gene Symbol Iqgap1
Ensembl Gene ENSMUSG00000030536
Gene NameIQ motif containing GTPase activating protein 1
SynonymsD7Ertd237e, D7Ertd257e
MMRRC Submission 043224-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5843 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location80711583-80825974 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80726080 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1349 (N1349S)
Ref Sequence ENSEMBL: ENSMUSP00000128278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167377]
Predicted Effect probably benign
Transcript: ENSMUST00000167377
AA Change: N1349S

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000128278
Gene: ENSMUSG00000030536
AA Change: N1349S

DomainStartEndE-ValueType
CH 46 155 2.02e-20 SMART
internal_repeat_1 203 278 3.71e-8 PROSPERO
low complexity region 324 335 N/A INTRINSIC
low complexity region 390 399 N/A INTRINSIC
coiled coil region 488 515 N/A INTRINSIC
internal_repeat_1 608 684 3.71e-8 PROSPERO
IQ 744 766 3.85e-3 SMART
IQ 774 796 1.12e-4 SMART
IQ 804 826 1.32e-1 SMART
IQ 834 856 1.15e1 SMART
coiled coil region 886 914 N/A INTRINSIC
RasGAP 992 1345 7.46e-89 SMART
Pfam:RasGAP_C 1452 1580 4.5e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205606
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains four IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. Expression of the protein is upregulated by gene amplification in two gastric cancer cell lines. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null allele exhibit a late-onset gastric hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,609,550 T93A probably damaging Het
Atp6v1h T A 1: 5,162,089 probably null Het
Ccnk T C 12: 108,193,730 V157A probably damaging Het
Cdh10 T C 15: 18,985,200 F317L possibly damaging Het
Chn1 A G 2: 73,679,748 I139T probably benign Het
Creld2 A T 15: 88,826,429 D349V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Frem1 T C 4: 82,936,052 D1660G probably damaging Het
Hipk3 A C 2: 104,440,224 S470R possibly damaging Het
Hook2 T A 8: 84,991,283 I37K probably damaging Het
Hpcal1 T C 12: 17,791,199 F193L probably benign Het
Hps4 T C 5: 112,349,430 probably null Het
Khk A G 5: 30,921,931 I6V possibly damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrch3 T C 16: 32,998,526 V629A probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Muc13 A G 16: 33,806,051 Y320C probably damaging Het
Olfr10 A T 11: 49,318,249 R234S probably benign Het
Olfr169 T A 16: 19,566,583 Q100L probably damaging Het
Olfr203 T A 16: 59,303,361 D69E probably damaging Het
Parpbp A G 10: 88,133,191 L131P probably damaging Het
Prl3a1 T C 13: 27,270,110 W24R probably damaging Het
Ptprk T A 10: 28,493,064 N677K probably damaging Het
Rbm39 A T 2: 156,162,873 D181E possibly damaging Het
Ros1 T C 10: 52,166,197 T220A possibly damaging Het
Slc46a3 T C 5: 147,886,211 I274V probably benign Het
Tas2r104 T A 6: 131,684,975 N257I probably damaging Het
Timeless A G 10: 128,244,244 probably null Het
Tmem63a T C 1: 180,972,833 probably null Het
Traf5 T C 1: 191,997,485 D535G possibly damaging Het
Trank1 C T 9: 111,365,860 S984L possibly damaging Het
Trpm6 A G 19: 18,856,175 T1573A probably benign Het
Ube3b T A 5: 114,412,299 I835N probably damaging Het
Wnt16 T A 6: 22,290,948 I125N probably damaging Het
Xirp2 G T 2: 67,476,785 probably benign Het
Zc3h12c G T 9: 52,116,682 T460K probably benign Het
Zfp651 T C 9: 121,767,339 F624S possibly damaging Het
Zfp865 C A 7: 5,030,417 T467K probably benign Het
Zim1 A G 7: 6,677,698 V322A possibly damaging Het
Other mutations in Iqgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Iqgap1 APN 7 80759844 missense probably benign 0.00
IGL00984:Iqgap1 APN 7 80726798 missense probably damaging 1.00
IGL01570:Iqgap1 APN 7 80723061 missense possibly damaging 0.76
IGL01738:Iqgap1 APN 7 80723900 missense possibly damaging 0.80
IGL02141:Iqgap1 APN 7 80738121 missense probably damaging 1.00
IGL02336:Iqgap1 APN 7 80752293 missense probably benign 0.39
IGL02416:Iqgap1 APN 7 80726038 missense probably damaging 1.00
IGL02597:Iqgap1 APN 7 80723885 missense probably damaging 1.00
IGL02662:Iqgap1 APN 7 80743079 missense probably benign
IGL03157:Iqgap1 APN 7 80751888 missense probably benign 0.34
IGL03189:Iqgap1 APN 7 80713842 missense probably benign 0.12
IGL03216:Iqgap1 APN 7 80743088 missense probably benign 0.33
R0024:Iqgap1 UTSW 7 80751939 missense probably benign
R0126:Iqgap1 UTSW 7 80738322 missense probably benign 0.00
R0144:Iqgap1 UTSW 7 80751920 missense probably damaging 1.00
R0325:Iqgap1 UTSW 7 80751930 missense probably benign 0.01
R0376:Iqgap1 UTSW 7 80723879 missense probably benign 0.01
R0650:Iqgap1 UTSW 7 80736395 missense probably damaging 1.00
R0652:Iqgap1 UTSW 7 80736395 missense probably damaging 1.00
R0741:Iqgap1 UTSW 7 80720987 missense probably benign 0.03
R0751:Iqgap1 UTSW 7 80725573 unclassified probably benign
R1067:Iqgap1 UTSW 7 80723828 missense probably benign 0.01
R1389:Iqgap1 UTSW 7 80759756 critical splice donor site probably null
R1473:Iqgap1 UTSW 7 80734011 missense probably benign 0.00
R1613:Iqgap1 UTSW 7 80768457 missense probably damaging 1.00
R1842:Iqgap1 UTSW 7 80760883 missense probably damaging 1.00
R1909:Iqgap1 UTSW 7 80743828 missense probably benign
R2062:Iqgap1 UTSW 7 80723979 nonsense probably null
R2149:Iqgap1 UTSW 7 80762560 missense probably damaging 1.00
R2153:Iqgap1 UTSW 7 80751953 missense probably benign 0.00
R2153:Iqgap1 UTSW 7 80759903 missense possibly damaging 0.55
R3160:Iqgap1 UTSW 7 80752338 missense probably benign
R3162:Iqgap1 UTSW 7 80752338 missense probably benign
R3605:Iqgap1 UTSW 7 80723789 missense probably benign 0.02
R3709:Iqgap1 UTSW 7 80717087 missense possibly damaging 0.87
R3935:Iqgap1 UTSW 7 80743837 missense possibly damaging 0.54
R3979:Iqgap1 UTSW 7 80759934 missense probably damaging 0.98
R4545:Iqgap1 UTSW 7 80762567 critical splice acceptor site probably null
R4787:Iqgap1 UTSW 7 80735513 missense probably damaging 1.00
R4925:Iqgap1 UTSW 7 80765317 missense probably damaging 1.00
R4953:Iqgap1 UTSW 7 80723776 splice site probably null
R5037:Iqgap1 UTSW 7 80734100 missense probably damaging 1.00
R5158:Iqgap1 UTSW 7 80743068 missense probably benign 0.02
R5183:Iqgap1 UTSW 7 80723065 missense probably damaging 1.00
R5262:Iqgap1 UTSW 7 80726742 missense probably benign 0.00
R5271:Iqgap1 UTSW 7 80734148 missense probably damaging 1.00
R5289:Iqgap1 UTSW 7 80738724 missense possibly damaging 0.88
R5359:Iqgap1 UTSW 7 80766959 missense probably benign 0.00
R5423:Iqgap1 UTSW 7 80799862 missense probably damaging 1.00
R5849:Iqgap1 UTSW 7 80803158 missense probably benign
R6164:Iqgap1 UTSW 7 80809106 missense unknown
R6315:Iqgap1 UTSW 7 80799890 missense possibly damaging 0.65
R6335:Iqgap1 UTSW 7 80728024 missense probably damaging 1.00
R6488:Iqgap1 UTSW 7 80730326 missense probably benign 0.00
R6723:Iqgap1 UTSW 7 80723822 missense probably benign 0.01
R6800:Iqgap1 UTSW 7 80728981 missense possibly damaging 0.56
R6815:Iqgap1 UTSW 7 80766884 critical splice donor site probably null
R7240:Iqgap1 UTSW 7 80759839 missense probably benign 0.22
R7386:Iqgap1 UTSW 7 80726042 missense probably damaging 1.00
R7387:Iqgap1 UTSW 7 80720990 missense probably benign 0.03
R7410:Iqgap1 UTSW 7 80723030 nonsense probably null
R7429:Iqgap1 UTSW 7 80751440 missense probably benign 0.00
R7452:Iqgap1 UTSW 7 80760829 missense possibly damaging 0.80
X0064:Iqgap1 UTSW 7 80720931 nonsense probably null
X0067:Iqgap1 UTSW 7 80766903 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGTGACTGTACAATACCAGCAAAC -3'
(R):5'- GGCATATTGGCTTTTACTTCCCAG -3'

Sequencing Primer
(F):5'- TAAGTCCAAACGCCGTGCAG -3'
(R):5'- TTCCCAGTGAAAACTGCCTG -3'
Posted On2016-12-20