Incidental Mutation 'R5843:Zfp651'
ID450548
Institutional Source Beutler Lab
Gene Symbol Zfp651
Ensembl Gene ENSMUSG00000013419
Gene Namezinc finger protein 651
Synonyms4732420M22Rik
MMRRC Submission 043224-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R5843 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location121759330-121771742 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121767339 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 624 (F624S)
Ref Sequence ENSEMBL: ENSMUSP00000091286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093772]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093772
AA Change: F624S

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000091286
Gene: ENSMUSG00000013419
AA Change: F624S

DomainStartEndE-ValueType
BTB 45 141 3.69e-19 SMART
low complexity region 159 164 N/A INTRINSIC
low complexity region 197 210 N/A INTRINSIC
low complexity region 217 231 N/A INTRINSIC
low complexity region 302 339 N/A INTRINSIC
low complexity region 355 372 N/A INTRINSIC
ZnF_C2H2 447 470 1.28e-3 SMART
ZnF_C2H2 474 494 8.4e1 SMART
ZnF_C2H2 501 524 1.76e-1 SMART
ZnF_C2H2 531 553 3.34e-2 SMART
ZnF_C2H2 559 581 6.78e-3 SMART
ZnF_C2H2 587 609 3.63e-3 SMART
ZnF_C2H2 615 637 1.95e-3 SMART
ZnF_C2H2 643 665 6.62e-6 SMART
ZnF_C2H2 671 698 4.16e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213743
Predicted Effect probably benign
Transcript: ENSMUST00000214732
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215081
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,609,550 T93A probably damaging Het
Atp6v1h T A 1: 5,162,089 probably null Het
Ccnk T C 12: 108,193,730 V157A probably damaging Het
Cdh10 T C 15: 18,985,200 F317L possibly damaging Het
Chn1 A G 2: 73,679,748 I139T probably benign Het
Creld2 A T 15: 88,826,429 D349V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Frem1 T C 4: 82,936,052 D1660G probably damaging Het
Hipk3 A C 2: 104,440,224 S470R possibly damaging Het
Hook2 T A 8: 84,991,283 I37K probably damaging Het
Hpcal1 T C 12: 17,791,199 F193L probably benign Het
Hps4 T C 5: 112,349,430 probably null Het
Iqgap1 T C 7: 80,726,080 N1349S probably benign Het
Khk A G 5: 30,921,931 I6V possibly damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrch3 T C 16: 32,998,526 V629A probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Muc13 A G 16: 33,806,051 Y320C probably damaging Het
Olfr10 A T 11: 49,318,249 R234S probably benign Het
Olfr169 T A 16: 19,566,583 Q100L probably damaging Het
Olfr203 T A 16: 59,303,361 D69E probably damaging Het
Parpbp A G 10: 88,133,191 L131P probably damaging Het
Prl3a1 T C 13: 27,270,110 W24R probably damaging Het
Ptprk T A 10: 28,493,064 N677K probably damaging Het
Rbm39 A T 2: 156,162,873 D181E possibly damaging Het
Ros1 T C 10: 52,166,197 T220A possibly damaging Het
Slc46a3 T C 5: 147,886,211 I274V probably benign Het
Tas2r104 T A 6: 131,684,975 N257I probably damaging Het
Timeless A G 10: 128,244,244 probably null Het
Tmem63a T C 1: 180,972,833 probably null Het
Traf5 T C 1: 191,997,485 D535G possibly damaging Het
Trank1 C T 9: 111,365,860 S984L possibly damaging Het
Trpm6 A G 19: 18,856,175 T1573A probably benign Het
Ube3b T A 5: 114,412,299 I835N probably damaging Het
Wnt16 T A 6: 22,290,948 I125N probably damaging Het
Xirp2 G T 2: 67,476,785 probably benign Het
Zc3h12c G T 9: 52,116,682 T460K probably benign Het
Zfp865 C A 7: 5,030,417 T467K probably benign Het
Zim1 A G 7: 6,677,698 V322A possibly damaging Het
Other mutations in Zfp651
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01913:Zfp651 APN 9 121763969 missense probably damaging 1.00
R0193:Zfp651 UTSW 9 121767666 missense probably damaging 0.98
R0270:Zfp651 UTSW 9 121767575 missense probably benign 0.27
R0347:Zfp651 UTSW 9 121763102 missense probably damaging 1.00
R0654:Zfp651 UTSW 9 121763261 missense probably benign 0.01
R2202:Zfp651 UTSW 9 121762637 missense possibly damaging 0.53
R2203:Zfp651 UTSW 9 121762637 missense possibly damaging 0.53
R2204:Zfp651 UTSW 9 121762637 missense possibly damaging 0.53
R2205:Zfp651 UTSW 9 121762637 missense possibly damaging 0.53
R2364:Zfp651 UTSW 9 121767594 missense probably damaging 0.98
R3843:Zfp651 UTSW 9 121763433 missense possibly damaging 0.86
R4275:Zfp651 UTSW 9 121766539 missense probably damaging 1.00
R4934:Zfp651 UTSW 9 121763979 missense probably damaging 0.99
R5358:Zfp651 UTSW 9 121765595 missense probably damaging 1.00
R5462:Zfp651 UTSW 9 121767663 missense probably damaging 0.99
R5613:Zfp651 UTSW 9 121767519 missense probably damaging 1.00
R5863:Zfp651 UTSW 9 121767530 missense probably benign 0.22
R6009:Zfp651 UTSW 9 121762871 missense possibly damaging 0.86
R6063:Zfp651 UTSW 9 121763532 missense probably benign 0.01
R6114:Zfp651 UTSW 9 121765595 missense probably damaging 1.00
R6223:Zfp651 UTSW 9 121763787 missense possibly damaging 0.61
R6414:Zfp651 UTSW 9 121763659 missense probably benign
R6811:Zfp651 UTSW 9 121766529 missense probably damaging 1.00
R7394:Zfp651 UTSW 9 121767345 missense probably damaging 0.98
R7430:Zfp651 UTSW 9 121763666 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACCTTAGGAAACACTGGCCTAC -3'
(R):5'- CGATGCCGCTTCATATTGGG -3'

Sequencing Primer
(F):5'- ACTGGCCTACACACAGGTTG -3'
(R):5'- TGGTGAAACTCTTGCCACAG -3'
Posted On2016-12-20