Incidental Mutation 'R5843:Timeless'
ID450552
Institutional Source Beutler Lab
Gene Symbol Timeless
Ensembl Gene ENSMUSG00000039994
Gene Nametimeless circadian clock 1
Synonymstim
MMRRC Submission 043224-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5843 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location128232065-128252941 bp(+) (GRCm38)
Type of Mutationunclassified (2569 bp from exon)
DNA Base Change (assembly) A to G at 128244244 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055539] [ENSMUST00000105242] [ENSMUST00000105243] [ENSMUST00000105244] [ENSMUST00000105245] [ENSMUST00000125289]
Predicted Effect probably benign
Transcript: ENSMUST00000055539
AA Change: M421V

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000058021
Gene: ENSMUSG00000039994
AA Change: M421V

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.2e-102 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1197 1.9e-186 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105240
Predicted Effect probably benign
Transcript: ENSMUST00000105242
AA Change: M421V

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000100876
Gene: ENSMUSG00000039994
AA Change: M421V

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.1e-102 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1196 4.4e-187 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105243
AA Change: M421V

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000100877
Gene: ENSMUSG00000039994
AA Change: M421V

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 7.8e-104 PFAM
low complexity region 381 395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105244
AA Change: M421V

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000100878
Gene: ENSMUSG00000039994
AA Change: M421V

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.3e-103 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1196 5e-187 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105245
AA Change: M421V

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000100879
Gene: ENSMUSG00000039994
AA Change: M421V

DomainStartEndE-ValueType
Pfam:TIMELESS 24 284 1.1e-81 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1197 1.9e-186 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000125289
SMART Domains Protein: ENSMUSP00000132079
Gene: ENSMUSG00000039994

DomainStartEndE-ValueType
Pfam:TIMELESS 1 123 3.6e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146945
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is highly conserved and is involved in cell survival after damage or stress, increase in DNA polymerase epsilon activity, maintenance of telomere length, and epithelial cell morphogenesis. The encoded protein also plays a role in the circadian rhythm autoregulatory loop, interacting with the PERIOD genes (PER1, PER2, and PER3) and others to downregulate activation of PER1 by CLOCK/ARNTL. Changes in this gene or its expression may promote prostate cancer, lung cancer, breast cancer, and mental disorders. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit early embryonic lethality at aprroximately the time of implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,609,550 T93A probably damaging Het
Atp6v1h T A 1: 5,162,089 probably null Het
Ccnk T C 12: 108,193,730 V157A probably damaging Het
Cdh10 T C 15: 18,985,200 F317L possibly damaging Het
Chn1 A G 2: 73,679,748 I139T probably benign Het
Creld2 A T 15: 88,826,429 D349V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Frem1 T C 4: 82,936,052 D1660G probably damaging Het
Hipk3 A C 2: 104,440,224 S470R possibly damaging Het
Hook2 T A 8: 84,991,283 I37K probably damaging Het
Hpcal1 T C 12: 17,791,199 F193L probably benign Het
Hps4 T C 5: 112,349,430 probably null Het
Iqgap1 T C 7: 80,726,080 N1349S probably benign Het
Khk A G 5: 30,921,931 I6V possibly damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrch3 T C 16: 32,998,526 V629A probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Muc13 A G 16: 33,806,051 Y320C probably damaging Het
Olfr10 A T 11: 49,318,249 R234S probably benign Het
Olfr169 T A 16: 19,566,583 Q100L probably damaging Het
Olfr203 T A 16: 59,303,361 D69E probably damaging Het
Parpbp A G 10: 88,133,191 L131P probably damaging Het
Prl3a1 T C 13: 27,270,110 W24R probably damaging Het
Ptprk T A 10: 28,493,064 N677K probably damaging Het
Rbm39 A T 2: 156,162,873 D181E possibly damaging Het
Ros1 T C 10: 52,166,197 T220A possibly damaging Het
Slc46a3 T C 5: 147,886,211 I274V probably benign Het
Tas2r104 T A 6: 131,684,975 N257I probably damaging Het
Tmem63a T C 1: 180,972,833 probably null Het
Traf5 T C 1: 191,997,485 D535G possibly damaging Het
Trank1 C T 9: 111,365,860 S984L possibly damaging Het
Trpm6 A G 19: 18,856,175 T1573A probably benign Het
Ube3b T A 5: 114,412,299 I835N probably damaging Het
Wnt16 T A 6: 22,290,948 I125N probably damaging Het
Xirp2 G T 2: 67,476,785 probably benign Het
Zc3h12c G T 9: 52,116,682 T460K probably benign Het
Zfp651 T C 9: 121,767,339 F624S possibly damaging Het
Zfp865 C A 7: 5,030,417 T467K probably benign Het
Zim1 A G 7: 6,677,698 V322A possibly damaging Het
Other mutations in Timeless
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Timeless APN 10 128241708 missense probably damaging 1.00
IGL02157:Timeless APN 10 128242386 missense probably benign 0.01
IGL02300:Timeless APN 10 128244807 missense probably benign 0.00
IGL02587:Timeless APN 10 128239916 missense probably damaging 0.99
IGL02588:Timeless APN 10 128243334 missense probably damaging 1.00
IGL02892:Timeless APN 10 128244251 missense probably damaging 1.00
IGL02930:Timeless APN 10 128247191 missense probably benign 0.00
IGL02986:Timeless APN 10 128249760 missense possibly damaging 0.82
IGL03345:Timeless APN 10 128247586 missense probably benign 0.04
IGL03393:Timeless APN 10 128252055 missense probably damaging 1.00
R0388:Timeless UTSW 10 128241425 intron probably null
R0607:Timeless UTSW 10 128246334 missense probably benign
R0638:Timeless UTSW 10 128244673 nonsense probably null
R0734:Timeless UTSW 10 128250060 missense probably damaging 1.00
R1346:Timeless UTSW 10 128242365 missense possibly damaging 0.83
R1625:Timeless UTSW 10 128240624 missense probably damaging 0.99
R1771:Timeless UTSW 10 128247608 missense probably benign 0.11
R1860:Timeless UTSW 10 128246114 missense probably benign 0.00
R1920:Timeless UTSW 10 128241714 missense probably damaging 1.00
R1988:Timeless UTSW 10 128244187 missense probably damaging 0.98
R2981:Timeless UTSW 10 128248458 missense probably benign 0.34
R4359:Timeless UTSW 10 128247342 missense probably benign 0.00
R4647:Timeless UTSW 10 128239956 missense possibly damaging 0.80
R4753:Timeless UTSW 10 128240020 utr 5 prime probably benign
R4868:Timeless UTSW 10 128247361 missense probably benign
R4901:Timeless UTSW 10 128250762 missense probably damaging 1.00
R4956:Timeless UTSW 10 128241651 missense probably damaging 1.00
R5341:Timeless UTSW 10 128247178 missense possibly damaging 0.81
R5439:Timeless UTSW 10 128241735 missense probably damaging 1.00
R5585:Timeless UTSW 10 128240243 missense probably damaging 0.97
R5842:Timeless UTSW 10 128247459 critical splice donor site probably null
R6005:Timeless UTSW 10 128244200 missense probably damaging 0.99
R6271:Timeless UTSW 10 128250724 missense probably damaging 1.00
R6558:Timeless UTSW 10 128249563 missense probably benign 0.01
R6694:Timeless UTSW 10 128239999 critical splice donor site probably null
R6738:Timeless UTSW 10 128240635 missense probably damaging 1.00
R6760:Timeless UTSW 10 128246117 missense probably benign 0.38
R7213:Timeless UTSW 10 128243289 missense probably benign
R7248:Timeless UTSW 10 128252001 missense probably benign
R7345:Timeless UTSW 10 128249754 missense probably damaging 1.00
R7463:Timeless UTSW 10 128250426 missense probably benign 0.00
R7513:Timeless UTSW 10 128249530 missense probably damaging 0.99
R7574:Timeless UTSW 10 128244669 missense probably damaging 1.00
X0028:Timeless UTSW 10 128250325 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCATCTGCTTCGGGAGAGAG -3'
(R):5'- GGCACATGTCCATCTCGTTCAC -3'

Sequencing Primer
(F):5'- CTTCGGGAGAGAGCGCAG -3'
(R):5'- TGCATCCTGCCAAAGTGGAC -3'
Posted On2016-12-20