Incidental Mutation 'R5843:Hpcal1'
ID450555
Institutional Source Beutler Lab
Gene Symbol Hpcal1
Ensembl Gene ENSMUSG00000071379
Gene Namehippocalcin-like 1
SynonymsVnsl3, neural visinin-like 3, VILIP3, visinin like 3, Nvp3
MMRRC Submission 043224-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R5843 (G1)
Quality Score146
Status Not validated
Chromosome12
Chromosomal Location17690856-17791933 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17791199 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 193 (F193L)
Ref Sequence ENSEMBL: ENSMUSP00000071756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071858] [ENSMUST00000222944]
Predicted Effect probably benign
Transcript: ENSMUST00000071858
AA Change: F193L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000071756
Gene: ENSMUSG00000071379
AA Change: F193L

DomainStartEndE-ValueType
EFh 64 92 2.37e-3 SMART
EFh 100 128 5.78e-7 SMART
EFh 148 176 7.4e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222944
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of neuron-specific calcium-binding proteins family found in the retina and brain. It is highly similar to human hippocalcin protein and nearly identical to the rat and mouse hippocalcin like-1 proteins. It may be involved in the calcium-dependent regulation of rhodopsin phosphorylation and may be of relevance for neuronal signalling in the central nervous system. Several alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,609,550 T93A probably damaging Het
Atp6v1h T A 1: 5,162,089 probably null Het
Ccnk T C 12: 108,193,730 V157A probably damaging Het
Cdh10 T C 15: 18,985,200 F317L possibly damaging Het
Chn1 A G 2: 73,679,748 I139T probably benign Het
Creld2 A T 15: 88,826,429 D349V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Frem1 T C 4: 82,936,052 D1660G probably damaging Het
Hipk3 A C 2: 104,440,224 S470R possibly damaging Het
Hook2 T A 8: 84,991,283 I37K probably damaging Het
Hps4 T C 5: 112,349,430 probably null Het
Iqgap1 T C 7: 80,726,080 N1349S probably benign Het
Khk A G 5: 30,921,931 I6V possibly damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrch3 T C 16: 32,998,526 V629A probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Muc13 A G 16: 33,806,051 Y320C probably damaging Het
Olfr10 A T 11: 49,318,249 R234S probably benign Het
Olfr169 T A 16: 19,566,583 Q100L probably damaging Het
Olfr203 T A 16: 59,303,361 D69E probably damaging Het
Parpbp A G 10: 88,133,191 L131P probably damaging Het
Prl3a1 T C 13: 27,270,110 W24R probably damaging Het
Ptprk T A 10: 28,493,064 N677K probably damaging Het
Rbm39 A T 2: 156,162,873 D181E possibly damaging Het
Ros1 T C 10: 52,166,197 T220A possibly damaging Het
Slc46a3 T C 5: 147,886,211 I274V probably benign Het
Tas2r104 T A 6: 131,684,975 N257I probably damaging Het
Timeless A G 10: 128,244,244 probably null Het
Tmem63a T C 1: 180,972,833 probably null Het
Traf5 T C 1: 191,997,485 D535G possibly damaging Het
Trank1 C T 9: 111,365,860 S984L possibly damaging Het
Trpm6 A G 19: 18,856,175 T1573A probably benign Het
Ube3b T A 5: 114,412,299 I835N probably damaging Het
Wnt16 T A 6: 22,290,948 I125N probably damaging Het
Xirp2 G T 2: 67,476,785 probably benign Het
Zc3h12c G T 9: 52,116,682 T460K probably benign Het
Zfp651 T C 9: 121,767,339 F624S possibly damaging Het
Zfp865 C A 7: 5,030,417 T467K probably benign Het
Zim1 A G 7: 6,677,698 V322A possibly damaging Het
Other mutations in Hpcal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Hpcal1 APN 12 17791145 missense probably benign 0.00
IGL00957:Hpcal1 APN 12 17787590 missense probably benign 0.17
R0137:Hpcal1 UTSW 12 17786388 missense probably damaging 1.00
R0920:Hpcal1 UTSW 12 17791097 splice site probably benign
R1490:Hpcal1 UTSW 12 17786224 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCCATTTTCCAGAGGGCTC -3'
(R):5'- AAAAGTCCTGTCTGGTGTCCTTAAG -3'

Sequencing Primer
(F):5'- TTCCAGAGGGCTCCAGACTTTAAG -3'
(R):5'- CACTTGAACCATTGGAAGGAGCC -3'
Posted On2016-12-20