Incidental Mutation 'R5843:Cdh10'
ID450558
Institutional Source Beutler Lab
Gene Symbol Cdh10
Ensembl Gene ENSMUSG00000022321
Gene Namecadherin 10
SynonymsT2-cadherin, C030003B10Rik, C030011H18Rik, A830016G23Rik
MMRRC Submission 043224-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R5843 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location18818947-19014236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18985200 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 317 (F317L)
Ref Sequence ENSEMBL: ENSMUSP00000128782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040562] [ENSMUST00000166873] [ENSMUST00000176146]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040562
AA Change: F317L

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000042199
Gene: ENSMUSG00000022321
AA Change: F317L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 77 158 2.8e-14 SMART
CA 182 267 1.03e-30 SMART
CA 291 383 6.04e-19 SMART
CA 406 487 6.23e-21 SMART
CA 510 594 3.56e-7 SMART
transmembrane domain 612 634 N/A INTRINSIC
Pfam:Cadherin_C 635 782 9.2e-58 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000166873
AA Change: F317L

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128782
Gene: ENSMUSG00000022321
AA Change: F317L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 77 158 2.8e-14 SMART
CA 182 267 1.03e-30 SMART
CA 291 383 6.04e-19 SMART
CA 406 487 6.23e-21 SMART
CA 510 594 3.56e-7 SMART
transmembrane domain 612 634 N/A INTRINSIC
Pfam:Cadherin_C 637 783 1.1e-54 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000176146
AA Change: F317L

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135546
Gene: ENSMUSG00000022321
AA Change: F317L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 77 158 2.8e-14 SMART
CA 182 267 1.03e-30 SMART
CA 291 383 6.04e-19 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. This gene is expressed in the blood-brain barrier and retinal endothelia suggesting a role in the development and maintenance of brain barrier. Alternative splicing results in multiple transcript variants. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 15. [provided by RefSeq, Oct 2015]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,609,550 T93A probably damaging Het
Atp6v1h T A 1: 5,162,089 probably null Het
Ccnk T C 12: 108,193,730 V157A probably damaging Het
Chn1 A G 2: 73,679,748 I139T probably benign Het
Creld2 A T 15: 88,826,429 D349V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Frem1 T C 4: 82,936,052 D1660G probably damaging Het
Hipk3 A C 2: 104,440,224 S470R possibly damaging Het
Hook2 T A 8: 84,991,283 I37K probably damaging Het
Hpcal1 T C 12: 17,791,199 F193L probably benign Het
Hps4 T C 5: 112,349,430 probably null Het
Iqgap1 T C 7: 80,726,080 N1349S probably benign Het
Khk A G 5: 30,921,931 I6V possibly damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrch3 T C 16: 32,998,526 V629A probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Muc13 A G 16: 33,806,051 Y320C probably damaging Het
Olfr10 A T 11: 49,318,249 R234S probably benign Het
Olfr169 T A 16: 19,566,583 Q100L probably damaging Het
Olfr203 T A 16: 59,303,361 D69E probably damaging Het
Parpbp A G 10: 88,133,191 L131P probably damaging Het
Prl3a1 T C 13: 27,270,110 W24R probably damaging Het
Ptprk T A 10: 28,493,064 N677K probably damaging Het
Rbm39 A T 2: 156,162,873 D181E possibly damaging Het
Ros1 T C 10: 52,166,197 T220A possibly damaging Het
Slc46a3 T C 5: 147,886,211 I274V probably benign Het
Tas2r104 T A 6: 131,684,975 N257I probably damaging Het
Timeless A G 10: 128,244,244 probably null Het
Tmem63a T C 1: 180,972,833 probably null Het
Traf5 T C 1: 191,997,485 D535G possibly damaging Het
Trank1 C T 9: 111,365,860 S984L possibly damaging Het
Trpm6 A G 19: 18,856,175 T1573A probably benign Het
Ube3b T A 5: 114,412,299 I835N probably damaging Het
Wnt16 T A 6: 22,290,948 I125N probably damaging Het
Xirp2 G T 2: 67,476,785 probably benign Het
Zc3h12c G T 9: 52,116,682 T460K probably benign Het
Zfp651 T C 9: 121,767,339 F624S possibly damaging Het
Zfp865 C A 7: 5,030,417 T467K probably benign Het
Zim1 A G 7: 6,677,698 V322A possibly damaging Het
Other mutations in Cdh10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Cdh10 APN 15 19013263 missense probably damaging 1.00
IGL00540:Cdh10 APN 15 18963995 missense probably damaging 1.00
IGL00769:Cdh10 APN 15 18985099 missense possibly damaging 0.63
IGL00837:Cdh10 APN 15 19013404 missense probably benign
IGL01307:Cdh10 APN 15 18899800 missense probably benign 0.34
IGL01509:Cdh10 APN 15 18986798 missense possibly damaging 0.70
IGL01561:Cdh10 APN 15 18999926 missense possibly damaging 0.52
IGL01743:Cdh10 APN 15 18986769 missense probably benign 0.06
IGL02065:Cdh10 APN 15 19013256 missense probably damaging 1.00
IGL02083:Cdh10 APN 15 18986889 missense possibly damaging 0.79
IGL02238:Cdh10 APN 15 19013519 missense probably damaging 1.00
IGL02838:Cdh10 APN 15 18899763 missense probably damaging 1.00
IGL03397:Cdh10 APN 15 18964028 missense probably damaging 1.00
R0423:Cdh10 UTSW 15 18986879 missense probably benign 0.00
R0828:Cdh10 UTSW 15 18986751 missense possibly damaging 0.52
R1488:Cdh10 UTSW 15 19013263 missense probably damaging 1.00
R1563:Cdh10 UTSW 15 18986767 nonsense probably null
R1674:Cdh10 UTSW 15 18985066 missense probably benign 0.11
R1674:Cdh10 UTSW 15 19013330 missense probably damaging 1.00
R1737:Cdh10 UTSW 15 18964063 missense probably damaging 1.00
R1819:Cdh10 UTSW 15 18991965 nonsense probably null
R1865:Cdh10 UTSW 15 18899604 missense probably benign 0.01
R1953:Cdh10 UTSW 15 18966911 critical splice donor site probably null
R2439:Cdh10 UTSW 15 19013398 missense probably damaging 1.00
R3944:Cdh10 UTSW 15 18964249 missense probably benign
R4320:Cdh10 UTSW 15 18985165 missense probably benign 0.03
R4330:Cdh10 UTSW 15 18999959 missense probably damaging 1.00
R4765:Cdh10 UTSW 15 19013278 missense probably damaging 0.98
R4831:Cdh10 UTSW 15 19013578 missense probably benign 0.10
R5102:Cdh10 UTSW 15 18986885 missense probably benign 0.05
R5166:Cdh10 UTSW 15 19013360 missense probably damaging 0.99
R5217:Cdh10 UTSW 15 18966022 missense probably damaging 0.98
R5902:Cdh10 UTSW 15 18985255 critical splice donor site probably null
R6263:Cdh10 UTSW 15 18964068 missense possibly damaging 0.86
R6636:Cdh10 UTSW 15 18985173 missense probably damaging 0.99
R6770:Cdh10 UTSW 15 18985222 missense probably benign 0.09
R7046:Cdh10 UTSW 15 19013201 missense probably damaging 0.98
R7362:Cdh10 UTSW 15 18899694 missense probably benign
R7491:Cdh10 UTSW 15 19013359 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCATACGTGCACTCAAAGTACTAG -3'
(R):5'- ACTAGAGCCTTCTCATTTACGTG -3'

Sequencing Primer
(F):5'- ATGTGCACATATGGTAATGCAG -3'
(R):5'- GAGCCTTCTCATTTACGTGTAATG -3'
Posted On2016-12-20