Incidental Mutation 'R5843:Muc13'
ID450563
Institutional Source Beutler Lab
Gene Symbol Muc13
Ensembl Gene ENSMUSG00000022824
Gene Namemucin 13, epithelial transmembrane
Synonyms114/A10, Ly64
MMRRC Submission 043224-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5843 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location33794037-33819934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33806051 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 320 (Y320C)
Ref Sequence ENSEMBL: ENSMUSP00000110696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023520] [ENSMUST00000115044]
Predicted Effect probably damaging
Transcript: ENSMUST00000023520
AA Change: Y320C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023520
Gene: ENSMUSG00000022824
AA Change: Y320C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 236 273 4.63e-1 SMART
SEA 274 391 7.7e-29 SMART
internal_repeat_1 394 418 9.92e-6 PROSPERO
EGF_like 428 467 3.79e1 SMART
transmembrane domain 484 506 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115044
AA Change: Y320C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110696
Gene: ENSMUSG00000022824
AA Change: Y320C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 236 273 4.63e-1 SMART
SEA 274 391 7.7e-29 SMART
internal_repeat_1 394 418 9.92e-6 PROSPERO
EGF_like 428 467 3.79e1 SMART
transmembrane domain 484 506 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Epithelial mucins, such as MUC13, are a family of secreted and cell surface glycoproteins expressed by ductal and glandular epithelial tissues (Williams et al., 2001 [PubMed 11278439]).[supplied by OMIM, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,609,550 T93A probably damaging Het
Atp6v1h T A 1: 5,162,089 probably null Het
Ccnk T C 12: 108,193,730 V157A probably damaging Het
Cdh10 T C 15: 18,985,200 F317L possibly damaging Het
Chn1 A G 2: 73,679,748 I139T probably benign Het
Creld2 A T 15: 88,826,429 D349V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Frem1 T C 4: 82,936,052 D1660G probably damaging Het
Hipk3 A C 2: 104,440,224 S470R possibly damaging Het
Hook2 T A 8: 84,991,283 I37K probably damaging Het
Hpcal1 T C 12: 17,791,199 F193L probably benign Het
Hps4 T C 5: 112,349,430 probably null Het
Iqgap1 T C 7: 80,726,080 N1349S probably benign Het
Khk A G 5: 30,921,931 I6V possibly damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrch3 T C 16: 32,998,526 V629A probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Olfr10 A T 11: 49,318,249 R234S probably benign Het
Olfr169 T A 16: 19,566,583 Q100L probably damaging Het
Olfr203 T A 16: 59,303,361 D69E probably damaging Het
Parpbp A G 10: 88,133,191 L131P probably damaging Het
Prl3a1 T C 13: 27,270,110 W24R probably damaging Het
Ptprk T A 10: 28,493,064 N677K probably damaging Het
Rbm39 A T 2: 156,162,873 D181E possibly damaging Het
Ros1 T C 10: 52,166,197 T220A possibly damaging Het
Slc46a3 T C 5: 147,886,211 I274V probably benign Het
Tas2r104 T A 6: 131,684,975 N257I probably damaging Het
Timeless A G 10: 128,244,244 probably null Het
Tmem63a T C 1: 180,972,833 probably null Het
Traf5 T C 1: 191,997,485 D535G possibly damaging Het
Trank1 C T 9: 111,365,860 S984L possibly damaging Het
Trpm6 A G 19: 18,856,175 T1573A probably benign Het
Ube3b T A 5: 114,412,299 I835N probably damaging Het
Wnt16 T A 6: 22,290,948 I125N probably damaging Het
Xirp2 G T 2: 67,476,785 probably benign Het
Zc3h12c G T 9: 52,116,682 T460K probably benign Het
Zfp651 T C 9: 121,767,339 F624S possibly damaging Het
Zfp865 C A 7: 5,030,417 T467K probably benign Het
Zim1 A G 7: 6,677,698 V322A possibly damaging Het
Other mutations in Muc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Muc13 APN 16 33807959 nonsense probably null
IGL01561:Muc13 APN 16 33806041 missense possibly damaging 0.90
IGL02159:Muc13 APN 16 33799479 missense unknown
IGL02438:Muc13 APN 16 33807980 missense possibly damaging 0.77
IGL02549:Muc13 APN 16 33807969 missense probably damaging 1.00
IGL03222:Muc13 APN 16 33798965 missense unknown
R0006:Muc13 UTSW 16 33803148 missense probably damaging 0.99
R0734:Muc13 UTSW 16 33803082 missense probably damaging 0.99
R1869:Muc13 UTSW 16 33804600 missense probably damaging 1.00
R1940:Muc13 UTSW 16 33807911 missense probably benign 0.03
R1966:Muc13 UTSW 16 33814539 missense probably damaging 1.00
R2264:Muc13 UTSW 16 33808039 splice site probably null
R4254:Muc13 UTSW 16 33815851 missense probably benign 0.12
R6127:Muc13 UTSW 16 33798947 missense unknown
R7448:Muc13 UTSW 16 33814581 missense probably damaging 1.00
R7549:Muc13 UTSW 16 33799436 missense unknown
Predicted Primers PCR Primer
(F):5'- TTCCAAGCAAGCTGGCCTTC -3'
(R):5'- GTAGGGACAGTCTACCTTAGGAG -3'

Sequencing Primer
(F):5'- GCCTTTCATCTTGACATAAAAAGGG -3'
(R):5'- AGTCTACCTTAGGAGACTGAGCCTG -3'
Posted On2016-12-20